Description :
From Genome Similarity Track
Location :
Scaffold_206:16684- 18906
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_206-snap-gene-0.28N2,N2-dimethylguanosine tRNA methyltransferase
Pytap_DAOMBR444maker-pag1_scaffold_206-snap-gene-0.18Conserved gene of unknown function

Sequence
2222 bases(100 bases per row)
GCTCACGAGCTGAGAGTACTGAGACGCAAGGTAGTGCGCTAAGACGAGTGCGCAGGGCCAGACAAaGAGCCCAAAGTGTTTGTCAACGTCGTCTTCGGCC
TCTTGGATTTCGTCGATGAATTCCACCAGACGCACACTGACTGTTCGTGCACTTTCTACCTCAtccccAgTACTCAGTGATCGAGGGCGTTTACGTGCAG
ACGCATTAGCAGGCGCACGAGCGGCTTCCGAGTGACGTAGCGTGAAGCGTAGCTCCTTCATTCGCTTGTGCAGTGGATTGTGATACTGATTGGATTATAA
GTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGCCAAAAGaGAGCGCTTCGCCTGTTTGGTTACAAGCAGAAGACGATGATAGAACTCACGAACCCGGCACTGGAAGAGGATCCGT
GGGTGTGTCGCCCTGGGGTCTTGGCTTTGATGTTGTCTAGATGGACTCCTCGTGAGCGGTCGGTAGgTGGGctctcTCACAATCCGTGTTTcTTttACTC
TGAtATTTTGtCTGCTGAAGCGGTGGCGGAACTtCTTTTTAGAGATGCGACTTCAGAGCTACGGGGCTTTGCGAAGACTTCGACGTCGAGTGTCAACGTT
CTTTGATTGGACGCGGCGTGCAGCTATGACTGGCCTACTCAGGGCGAGTTGTCTTCAGTCAACGCCTGAACGCGAGCTTGGAGATTACGTTCTGAAACTC
GAAATGGGTCCGAGTTTTACAACTCATGCGGCAATCAATGCGACTTACTATAGTGACGCTGACTGTACGTAACCCTtTTTTCGAGCTGGCATGGCGCCTT
ACTCAGTCTGCACTGCTTTTGTGGGAGACAGCGGCAGCAACTTTGCATGAGCTCAAGTATCTTGAACGAGGCGCCGAGTGTTTTgcTTACATCGATTTTC
AGTGTCGAAACGGCACGAGAGGTACGTTgATGAAACCCGTTCAAAGATTTGACTCTGACTTATTCTTCTTTTGCCGAAGAATCCGATGCATTGTGGCTCT
GTCAACGGCTTACTGGTTTATTGAGCTCTATTTCAAAGATCACATCGAGTTGCTACCCCATTTCTTCAAGTGGTTCATCACAATCCCGACCAAGATGCAA
CTGCGATCcACAGGTGGCGGAGCCTCGTCAGGCTCCGGGACCGCAGCAGGAGCAGCTCCAATTGTTCGGATCGTGATTTTGTTCACAGGAGAAATGGATG
TTTACACCGTCATGCAAAGTCTCAACCTTCCGTCGTCAATGCAATTCGATCACTTGCTCCAGCGACTGTCGACGCGCTGGATGTTCAGTCATTCGATTGA
GGAAATCGTCACAAATAAACGGTTCGTCGCTGGAACGCAGTGGAGCTGCCGCGGTCAACTCGATATTCGGTTCAATCGCCAGGCGTGTGGCCAGATATGT
CGACAGTCCGCGATGAAAATGGATGATGAAATTGCAATGCAGAAGGAGGAAAGGGATTTTATGGCCCAGCAGCATGCCGAACAGGACGACAATATCACAG
GCAAAACGGCCCCTAAGTCGTTTCAGACCCATCGTGAAGGTTTCGAAGAAGATGAAATGGAGAACTCGTCATTATCATGGCGCACCTGGTTGCACCACCT
AGCTGCAGTCTcGgATTCATCACGAGAGCTCAGCTTGACATGGTCATTTACGGACTTGAAGATTCTGCTCGAAGACAACGCGTGGGTCAAGACCATTATG
ACTCCAGTGAGACTCCAGTGGC