Description :
From Genome Similarity Track
Location :
contig_31:166827- 168006
Transcript NameFunction/comments
g7135.t1hypothetical protein

Sequence
1179 bases(100 bases per row)
CAAAAGCCAGAAAGCAAGGAAGCATGTACCATACCCGAGTAGGACCAGCGACGTCGTCAGCTGCGAACTTCTCAGCCTACAACTTCAAAGTATTTTAATA
TGAACCACCTCACCGATGCATCGAAAGCGCTAAGCCGAGTGCATTTACCAAGTTAATCCTGCTTGAACTGACCAAACTCTGCTCACTGTTCTGCACCCTC
GTCAACTTGATCCGGTGTACTTTCGTCTTCATCAGCCTCGTTCGTCTCGATCTCAACGTCGTCTCCGTCGGCATCAGGCGAAGCTTCAGCGTTGTTGGAT
GCTGGTTCATTCTCTTCAGGCGACGCGGCGGCCTCTTCCGGTCTCGTGGCTTCGGTGGCTGCAACATCGGCGTCATCTTTTTTATCATCGGTCGTGACGA
CTGTGATGAGTTCCGTCGCCGTGATCGCGCTCTCGACCTCGTGTCTGTGCTGGTTGTCCAGCATTGGCATGACTTTGCCCAAAGTTACTGGGTCGGGGGT
AAGCGCTCTTCGCGATCTCTTCACCAGCTTCCACGCGTCGGAGACGTGCTCCACAGCAAGGCGGTACTTCTCGTTCGCTTCAATAGCGTAAGACTTCACT
GGGGCCTGCATAGTCTCCCAGGTAAGCTTCCGCTCCCCCGCCACTCGCTCCACGTCATTCTCGTGAATCGTATCCTCTGGCCACACGCACGTGAGTTCGT
GCGTGTTGTCGATCTTGTTCCTCTGGAAGCCCAGGCCTTCATCTGGTCTGTACCTTCGAGAGACCGACATGAGGAAGGGCTCCGCAAACTCTGGCAGCAT
CACCACTGGTAACTTTTCCTTTTCATGGAGGTTGTCGGTCTCCTTGGGTAGCGTCTCGCCGTCTTCCTTCGCGAGTAGTGACTGAACCAGCTCCACAGGG
AACAGCGCCGCTTGCTTCAAGAACGCCAGTATCTGGCCAAGTACGACGAGTACGAGACGGCCGAAGATCGTGTACAGCAGGAGGCCAAACGTGACTATGA
AGCACAGCACTGTCATCAGCATGACGTGAGAGTACACGATCTTGACCAAGAAACCGTACTGGCCCAGCACATCGTACTTCTGGAGCTTATCGGCCAGGAT
GCCGTAGAGCTGATCGGTTGTAGCGTTGGGGTTTTCCTTCAAGACGGACGAAAGCCCCACAGATCTCAGCAGCCATGGC