Description :
From Genome Similarity Track
Location :
contig_5:166817- 177752
Transcript NameFunction/comments
g1319.t1G patch domain-containing protein 1
g1320.t1hypothetical protein
g1321.t1Vesicle-associated membrane protein/synaptobrevin-binding protein
g1322.t1hypothetical protein

Sequence
10935 bases(100 bases per row)
CGACCACACGTGCAAATGGACTCGACGCTCGACCAGCTGCAGCGCACAAGCTCTTTTGCCTCCAGGTGGCTCTGTCGGTCTTCTGTTGCGACTGGCAATC
GGGTGTTCAGCACTTCGCAACCGCCGTCCCACACGCGCCTTTCGGCCATCAGTTCGCCTTCTCATCTGGTTCGCCTGTAGCCATGAGAAAGTCTATTTCG
CTGCCGATCGCGCCGCCTGTCAAGCTGCGCCGCCGCAAGTCGTTGCGGGAGGAGCAAATGAGTCGTTCATTCTCGTTCACCAAGCGCCGCGTCGAGCGGC
AGTCGTCGCGCCTCACACCGATGAAGTCCATGGAGCAGACGCTGCTGGACAACGTGCACGTGGTTCGTCAAGGCCGTGGTGCCCGGCCAGAACAAGCTGG
CCAGCCCGCGCTACGTCATGCGCATCAACAACACCGCGCTGGACCAGACGTGGGAGATGGCGAGGACATTCAAGGAGTTCTACGAGCTCAAGGAGGCGAT
CGTCCGCGTACTCGACTACGGCCACTTCTGTCCTTCAAACTGCCCGTGGCTCTACATGTACGCGGCGCACCACTTCCCGAGGCGCCACATCTTCCGTTCG
CGTAGCCCTTCCGTGATCGCCGGGCGACTCACCGAGCTGCAAACGTATTTTTCGACGCTGCTGCGCATGGCCAAGCAGAACCGCAACCTCGAGTGCGCAG
TGTCATCTACCAAGCTGCCGCAGCTCATCTACGATTTCCTGTTCGAGGGCATGGTTTTCGACCGCTCCGACTTCATGCGGTTGAGCGAGCGTCTCTCGAT
AAATACCCGCGACAGCAGCTTCCTCGACAACGACCCGACACAAGATCCGGAGGAATGCTTCATCTGTCGCAAGGCTCTGGTGGGCGACTCCAGCGTATCG
ATCGTCCCAGCAGCTCCAAGCAGTAACAGGGGGCCTTCGAGCAAGAAACGCGATAAGCACGTGATGGCGGGCCTCACGACTCTCGACTGCGGCCATTGCT
TCCACGACGAGTGCATTCTCGCGAAACTAAACGAGTCGCTGACTTGTCCACTGTGTATAGCGCAAACCAGTCCTCCACAGTCCGGCGTCGCTGCTGCCTA
GTTAACGAACAACCCGTGCACTAGAGACCTCTTAACCTAGCTAGAAGGCTGTGTGTACTTGTTCATAAATGACATGGGAGCCATATTCAAGCGCATCAAA
CCCCATTGCACCGTGGAGATTCATATCACCTCCAAACGATTAAAGTGCAGCAATACCCGCAGCGTGGCTCTTCTCGTCGTTTCGTCTACATGAAGCCACA
ACGAGACGGCAGTGACTATCTCTTCACGCTCAGGAGAAAGGCTCGGCGGTGTCGTGTTCTGTAGTACTTGTCTGTCTGTGTAAAACCCATTTTTTATATC
CAAAAACGAATAACCCAATACCAAATAACCCATTTATAGTAACTTGGGCATGAAGCGTGGGAACGTCCGCAACCAGGAGGTGCGTATCCCTCTCTGTCTC
CCCTCCTCGCTGTACCGACGGGCTTTTTCTCGGATGCGATAGGTAGTCAAACTCATCGTCTATCACTTCCACCGCTTTTCCGCAGGTTACGGACGAGCAA
GGCCGCCGGCGTTTCCACGGAGCCTTCACGGGCGGCTTCTCTGCTGGATACTACAACTCCGTGGGTAGTGCGGAAGGATGGACGCCACAGACGTTCTCGT
CTTCTCGGAGCAATCGCTCGTCCCAGATCCAGCAGCGGGCTGAGGATTTTATGGACGAGGACGACGACCCGCTGCTGGGCAAACGACTGGAGACCACGGA
ACGCTATGACACGCTGCAAAAGGGAGCCAAACGACAACTGCAACAGCAGCAACAAGTTGGCAAAGCTGGAGCTGAGCTATCCCAGGGTTCGCCTTGCCGG
ATGACTGGGTTCTGCCGGTGAACGACTCCGTTGGAGCTAAGTTGTTGAAGCACATGGGGTGGAAAGAAGGTCACGGCATCGGGCAGCGAGTACGCAGACG
CAAGTACGAGGAAATGGAGAAGGAGGGAGTGGAGGGACCGAAACTATTGATGCAAAGTGCTCATGAAAGAAAACAGAGTCAGAGCCGCAGGATGAAGAAG
AGGTGTACGTTCCGCCACGGAAAGTGTTTGACATTCAAAAGGCTTTTCCCAAGCCCAAGCTGGATCGGTATGGCGCGGGATTTGACCCGTATACGAACGC
TCCCGAGTTTGCGTTCCACAAGCAGCAAAAGGAGGAGAATCAGAGAATGAAGGAGGGGTCTCACCGTCAGGTGGTATCCTTTTCAGACGCTTTGAAAGCT
TCAAATGGCAGCAATCGCGCATCGGGGGATATGGACTGAGCGCGCTGGAAGAAGACGACGACGTCGATGTTTATGGAACTGTCTCAATGACAGAATTTGA
TCGGGTAATTGCCCCACTTGGAGCGAAGAATGACATTAAGCGGCTGGATTCATCAGCACTACCAGCGCGTCGGTATGAGAAGGCAAGACTCAGTCGAGCT
TTGTGCTCAGATGGACGACCTGTCCTTCCTGGGTTTGAGTTAGCAACGTCGAAGGAAAAGCCTCCGAAGGTAGTTAAATTGCGTCTCACTGTGCCGTCGG
ATTTCAAGGCCTTTCATCGCTTTGATGAGGAAGGAGGGCGCGATGATGCCGTAACAGCGTTGTATCGCAAGCATAATTTCTCCTCGGGTAGCGGTGGAAT
GGTTGTAACAGCGAACCAACGTGGCGTTCTCCTGGAAGACCAAGGGGAAATGGACGTAGCAATGCTGGCGCGGGAGTTGGTAGCGAGGTGAAGGGCCAGC
TGCGAGTGTGTTTGACTTGCTTGGCGAGGAGCAGAGGGCGAAACTGTTCGATGCTGCTGCTCAAGCGAAACAGGGGCTACCTTCGTCCAGAGTTGCACAT
ACTACTTCAGTCAAAGAGTTAGCCGCTCCGAAAGTTCGGCAACCACTTGTGCGTGGTGGTAGTGGTGACGACCAGTTTCGAGCAACGATTTCAGCGTCGA
TTGCGAAACGATTCGTTTCGTCAAAAGGTGCAAGCGACGAGGAAAAGAGCAAGCCTGATCCTACTCAAGAGGTTCACACGAAGGCGTCACGCCGGTCGCA
GAGTTTGTGGATCCCCGAATCACTTCTTTGCAAACGTTTCCACGTAAAATGTGCCGGACCGACTGGCTCTGGGGGAAAGATGACGATAGCGACAAGAAGC
GTGACCTCTTCGACAAGGAGCTCGTTCCCCATTTAGTAGAATTTGCCGCTGACCGAGCTGCTCATCAGCGTCCGCCAGAGAAGGCACGTGAAGCTTCGAA
ATCGGGCAAGGTTGCTGAAGATGAACGCGTGCTGCCACCTTTACCTGCAGTAAAACGAACCTCGGCCAGTCTGCTCAAATCGATTTTCGAGCCGTCGGAT
GAGTCTGAATTGAGTGACTACGATAGCGAGGATGAAGAAGGCGATGACGGCAATGTAGAAGAGATGGAGAAGCAAGATTCTGCCTCGAGCTTTCCCATCG
GGAGTGCTGAACAACTAGTGCGAAATCATCAGCACGACCAACGTGACGTGAGCTCAGAGTCAAGCTCGTCAGAAGATGAGGTTGGTGCTCACTCCTCGAT
GCTTGGCGCTAAAGTTGGCAATAAAGAAGATGACCGAGGCATCAAGCGACTGCGCAGTGAAGATGACACCGACAATGGAGATGCGAGACAAAAAAAGAAG
GACGAGAAGCGGAAGCACAAAAAACACAAGAAACACCACAAGCATCGCTCGTCGCGTGACGACAAGGACAAGAAGAGGAAAAAGGACAAAAAGGATCGAA
AGTCGCACAAGCACCGCTCCTCGAGACACTCCAGGCGAAGCAGAAGTCGAAGTGGGGAACGAAGCTCGGGTCACCGTCGTAGCTCCAGCAAACAGCACTA
GCAGTAAAGCTGGAACTTCAGTTCTCTACTAACAAGAGTACTTCAGTAATGGAAGGAGTAAACCGACGCTGTTGACACGGCGGCATGGCGATTATTTCGC
GTGGACTAGCCCAAGCACTTCAACTTGAACACAAAAAACGAACAAAACATTTTTGAGTCTCTATGTAAACAGAATCGATTGAAGCTCAAAGCAATGCAAA
AACTAATCAATACACGACAGAGGGCTGGCCCCTCTACCGAGTCAAGCACCGTTGCCTGGCGCTTAAAGCGCATGTGTCTCCCTGTGTTCGTAATCCTGGC
CTATTTGAAAGCTATCCCGCTCACAGCAGCCGCCATTAAATTAGTCGAAGGTCTTCTTGTTGCCCTGGAAGTTCTGGATGGACGACGGCTGGCGTCTGGG
GGACCATCACCACGGCCACCACGGCCACCGCCGCGACCACCGAAGCCACGGCCACCGCCACGGCCTCCGAAGCCACGGCCACCACCACGGCCTCCAAAGC
CACGACCACCGCCACGGCCACCATCAAATCCGCCGCGGCCTCCACGGCCTCCACCACGGCCGCCAAAACCACCACGGCCACCGCCGCTGTGCTGCTCGCG
GCTCTTGGCGTAGTTGACGCGAATGGCACGGCCGCTCACGTACGAGCCAGCAAGCTTCACAGCCTCGTCGACGGCCTCAGTCGTCTCAAAGTCAACGTGG
CCAAAGCCACGGAACTCGCCAGTCTCACGGTCCGTGGCCAAACGGCAGCTGAGGATTTCACCACACTCGCCGAAGGTTTCACGGATGGTGTTCTCATCCA
CGTCCCAGGACAGGTTGCCAATGAAGACGCTCGTGCAGCCCTCCGGCTTCTCGTCGAACATGTTCTTCTTCTCGGCCGTGCGGATTTTCATCCAGCGGCC
TCCAAAGTCTTGGCCGTCCATTGCAAGAGCAGCCTCAGCAGCCTCCGGAGTAGCGAAAGTCACGAAAGCAGTACCCGACGAGCGGCCGTTCTGCAGAGGG
ATGCGAGCGCCAGTCACCTCACCGCATCCGGCAAAGTGCTCCGTCACCTCCTCCTCCGTGGCGGACCACGGCAGACCGGCAATGAAGACCTCAAGGTCTT
CTGCGGGTTGGCAACAGCAGCGGCCTCGCCGTCCTCCTGCTTGTGGACCTTGTTGGACTTCTCACTAGCGTCCGAGTTCTTACGCTTCTTGGACACAATA
GGGGTCTCCTCCTCGTCCGAGGACGAGTCCGAGTCGCTGGACGACGAAGAAGACTCCTCCTTGGCAGTTTCTTGGCAGCCGGCTTCTCAGCCTCGTCATC
CGATGAGTCCGAGGACGAGCTGTCGCTGTCCTCCTTCTTAGCGGCAACCTTCTTGGCAGGGCAGCCTTCTTGGGAGCCTCCTCCTCATCAGACGAAGAGT
CCGAGCTCGAGTCCGAGCTCTCCTTCTTAGCGGCAACCTTCTTGGCCGGGGCGGCCTTCTTGGGGCCTCCTCCTCATCAGAAGAAGAGTCCGAGCTTGAG
TCCGAGCTCTCCTTCTTGGCCACCACCTTCTTGGCAGCAGTCTTCTTAGACACCACCTTCTTGGGGGCCTCCTCCTCGTCGGAGCTCGAGTCGGACGACG
AGCTGTCCGAAGCCACGGGCTTCTTGGTAGCGACCTTCTTGGCCACCACCACCTTCTTCTGCGGGCCTCGTCGCTGCTCGAGTCAGACGACGAGCTGTCG
CTGCTGGACGCAGGCTTCACGGCAACGGGCGTTTTCACCTTCTTGGCCATCGTGTGTAGAGCAATTGGAGAGTCGGGAGCTGTCGGGGCGTCGAGCGATT
GGCAAATGACCAGCGAAACACTCGCACAACAGGCCGTTGGCTGGGATACCTTCAAGCGTCAGCACCGGTTTGGTTGGCTGCCGCGCTGCATGGTACACTG
TGCCGCGTTTCATGTGAGCCACACGAAGTGTGTGGTGCACATGAAGCCAGTTCGTGAGGTTTTTTTCCCTTTCTCCCCGAGGCTTTATGTGTGGCGGGTG
TGGCCCCCCACACAACGACCACACAGTCTTTCTTTCGAAATCCGGCGCGCGAATAAATCCTAATAATGGTGGCAAGTGGCGACGAGAACGTGGCGGTGGA
CGTGGCGGTGGACGTGGCGGTGGAGGACGCGACCAAGGTCGAGCACGAGCCGGTGGTGGGTGAGAAGCGCCACGAGCGCTCCGAGGACATGGACCCGCTC
GTCCCGGACGTCGACGTCGACGTCGACGCCGCAGCCTCACAGGACTCGCAAGCGACGCAGGACGACGACATCCAAGACGTTGTGGCTAATATCAAAGAGG
CCACGGCCGTCGACGTGACGTTCGACGCCGCCGCCGCGGCTGCAGCCGTGGTGCCGCCCCCGAGGTCATGAAGACTGACTCGTCCACGCCCGTGCAAGAC
GCAGTCGCGGCGGCCGCGGCGGCTGGCGTCGGCGTGGACCCGAACGGTGCCGCCAACGTCAAGTTCGACAGCAAGCGCATGGCGCGCGTGTCGTTCAACT
CGTGGTTCGACTTCGACGCGTACTTTGAACTGTACATGCAGGAGACGTTCCAGCCGTTCCGCATGCGCTCGTCCTGCAGCGTCGAGGCATACCGCCGCAA
CCAGCAGAAGGTCATGCTCAACAACAAGAGCTCACGCGGACGCCGCCGAGTTCCCGGACGAGGCCATCCACCACCACCGGATATACATGTGCACGCACGC
CATGAAGGCGCGCTGCCGCGGCGCCACACGCGTCCTGGGCAAAAATACGCGGTATCGGCTGCATGGCCAAGATCAACGTCAAGATCACCCCGGCGGACAA
CCCGTCCAAGTAATGTGATCGTGACGGACAGGTACGAACGGCACCCGATTTGCTTGGTTATTTATTGTGATTTGAGATTGACCCGTTGTCTTTTGCTATT
GGTGCTGCAGGTTGTGTCGCACAACCACCCGGTGAGCCGCGAGATTTATGAGGCATATCCGGATGTGCTGCTCAAGATGATGCGGCGCAGCCAGCTGTCC
CAGTCGATGCTGGGTCACCCGCCCCCGCCCAAGTTTGAGACGCCTCAGCAGACGCAGAAGTACGAGCGCGCGATGAATACGTTCCAGTCGATCGCCGAGA
CCATGGCTCGGCTGGCTGACGAGGACTACGAGCAGCAGCTCGGGCAGCTGCAGCGGCTCTACCCCCGCCACGGAGCAGGATCAAACGGTCTGAGTATGAA
GTCGCGAGAGAGGCGAACGGTGGCTATATACCAATACGCGATGAGAAGAGGCTGCCAGCGAGATTCGATTTTTGCTCTTGCTGTGTAGCAACGTTCATGT
CCAGCATTCATGTGCACGCTAATGCATCGTTGTCACTTCACTGTGGCTCATGGGTACACAAGTTTTACTACATCCACAAAATTTGATTACCTTTTTGTGT
ATGCAATGTGTATCATTTGTGTTTGGTTTGTGTACCGAGGGGGAACTGAGAACAATACACGACATCTGCATCGCAGCCTCGTAACCGAAGCAGCGATGGC
GAGCAGCGGCGTGGACGTGGCGCTCGCGCCCAACTCGAGCGTGATTCTAGAGCCGGCGGACTCGCTGTCCTTCCATCTGCAGCCGCAGACGGCGCCCCAG
GCGGTATTGACGATCCGCAACGTGGCGGACGACCGGCAGATCGCCTTCAAGGTCAAGACGACGCGGCCGCTGCGGTACCTGGTGCGGCCCAACCAGGGAC
TGCTGGGGCCCAACGGCTCGGCCTCCGTCATGGTGATCCTGCAGCAGAAAGACTGTGACGAGCTGCTGCGACTGGACCCGGCCGAACGCCAACTGGCCAA
CGACAAGTTCCTCGTGCAGAGCATCTACGTGGACGACAGCTTCTACGAGCTGGTCAAGACCAAGTCCACCAAGGAGATGGCGGACGAGCTCACCAACATG
TGGGCGCGCACGGACAAGCGCGCGCTGTCCAACAAGAAATTGCGCTGCCGCTTCGTGCAGGACAGCGAAGAGTTGGGCCGTCCGCCGTCGCCGCCGAGTC
CACAGCGAGCGCCGTCGGCCAGCGCCTCGCCGGCCAAGACAGCGACCACGTCGGACATGAGATACCAGAGTAGACAGAGCGACGAGGTCGGGGACGAGGT
GGCCACGCCCGCGCAACTGTCGTCGGCATTGCTGCAGGACGACAAGCCGCAGGCGCCGAAAGTGGCGGAGAACAGGGAAGGAGGCAAGGAAGCGATCCAA
GAAGTTGCGGCACTTCGGAAGAAATACGACGAGGTAGGTGCAGGGTTGAGGTACTGTGGTGACGAGTGGGGCTAATGGAGGTGCGTTGTGTGCTTGATGG
TGCTCAGTTGGTGGCGTTCACAGTGCAGCTTACGGCTCAGCGCGACGTGTTGATGAGCGATCTGGACAAGACGCGGCAGCTGCTGCAGAAGGCGAGCACG
GATGCACAGCGCGTGAAGAAGCTTTCAGAGGAGTCATCGACTTGCGTCATCGGAAGAACAACGGAAACGGAGCTTCTGGTACGGAGGACTCGCAGGCGAT
TACGGGAAAGGGTCCCAAGGAACAAGGGGTACGTCTTGGCTCATGTTGATACGATAGGCTATGCTGGCAACTGACAGGTTTTGCTGTGACAGGCTTTTGG
ACCCTTGCACCTGCTGGTGTGCGCGATCATTTTCTTTTTAGTTGGGCGCTACTACTAGGCAACTTGCGTGCTACGTACGTACGCTGGAGTTAGGCAGAGA
CAGAAGGTGTTGCTGATGAACGAGGGAGGCAACAGCACGCTTGAAAAAAAAGGAAATTGAAGCAATAGAGCTTTCTGTCGAGCTGCGTGAAGACGCTGAC
TCGTGTTCACATGTGTGGAAGTAGGCCGGTAGTGCAACAATCTTGGTTACTTGAAGTAGACGAGAATCATATAGTAGGAAGAGTACTACGTAGTAAGTAG
ACCGATTCCGGACAGGAACCCTTCGGGCCTCTTGGTTCATGGTCAAACTGTCAAAAGTATTCGTGGAAACGAGACTTGCAGTGAACTTGATGGTGCATTT
GATAGCGGCAGATGGACTACAAGTTACTCGTACAACGCCCTCTTCTTGAATGTCTAGATCTGACGGATTGACATCGGCAGTGTTGCTGCTATAAAGTCGG
GTTGTGCTGATGTGTGGCTAGTTGAGAATTGCTGTGACGCTCATTTTGCGCTTGCCTTCCATGTCTAGCGGCGCGCAGGCCTTGCGCTTAGCATTCCGAG
TGCGGCAACTTTCCGCGGCACTGTCACCGCCGTCGCTGCTGATTCCAGACGCGTGCAAACCAGCGCTGTCTTTCATAGAAAGCATCGCAATTGCAGCTGC
ATCGCTGTCCGATTGGGTACCGGCAGGGGCAACACGCACTAGCACTGGAGGCAGGATGGGCTTTTCTTCCTGGGGACGACCGGCAAAGCGCAGTGGCGGC
ACCTCAGCATCATCGTCAGGGAAATTTGAGTCATCCGGATTGTCCTCGTACTCTCCATCGCCGTCATACGCGCTCTCAATCTTCCGAAGTTGTCGTACAT
CGTCGCGAAGGGCGTTTACTCGTACGAGTGTGACTGAATCTTCTGACCGTGGTGAAGCTTCATCCACTGAGCTTCTATACCTGCGTCCGTCATGGCGGCT
GCCACTTGCGCCGGGTGGAGTGTGACTTGGCGAATGGCTTGATGAGTTATTGTTACCAGAAGACGTGTCATCACCGACATCACCGCCGCCTGAGGTGGGG
CCTGAGCTGCCGGGTGCCTCCCCCGAAGGTGAGGAGGACGAACTACCGCCACCACCACTGCGTCGAGAGGACGACTTTTGCGCATCGTGCTGTTCGATAC
TTGAACCCGTTGCCTGCATGAAAATGTGCTCAAGGCGGTCGATCATTTGCAGCAGCGGCTCATACGTTGCGAAGGGCTGCTTCATCAGGATCGTGTGCAT
GAATTTGTTGCGTGTAGCATATCCCGTCCACTTGTCGTGCTTTTTCAAGATCTGAATGGCACAACGCAGTAGGCAACCAGACGTGAGTCAAGTTGCTTCA
ACAACATCAGGCAGACGGAAACGCTGCCAGGGGGACGAACCGCCTGACTCGACGCAGCGGTCAATATAGTTAGGATCCGACCTTGGAAATGCCGCAGAAG
TTCATCACGGCGAAGTTTTCCAGCAGCAGCAGCTCCTTGTACAGCGCCACGCAGTTTTTCATCAGCGCTGTTTTGGCTTCCTCGGATTCTGGGTTCGTCT
GGACGACATACCGCGAAATTGACAGTTAGACCTCCACGCTAATGTTTATCAAAAAGAATTCCAGCCCCATCAACAGCATTTCTCTTTTCAAATACCTTGA
GCTGCTGGAAACTGGCGTCAATGGCTGCCACCTGACTCGTGTGTTTGGCCTGCTCCTTGATGAAGAAATCGGCAATCTTCTTGATCTCCACACGCAGCGT
CCGGAAGAAGTTCATTTCATCCTGCGACTGGCCTGCTCCAGCAATCAGAACCAATAAGAACCTGTCCATCAAAACGACCTCCGCGCGGCACTCACGGATG
CTGTCGTTGTCCTCCTTGGCGGACGGTTTGATCTTGATTTTCACGAGCTTGTCGCCCTGCAGCTTCTCCTCCTTCTTGATCTGCGCGCAGTCCTTGATGA
TCTTCTTGAGCAGCTTATAGTCGGCCCAAAAGGGCTCCCAGGCCGACGGCGACATCTGCGTCGACTGCTGCAACACTTTGCCGAACTTCATTTCGACCTC
TTCACTCCTAAAACGCAATCGCGGTCTGAGCAGACAAAGCAACTGATAACCAGTCAGCGGGCAGATTTTGCTCTTCTGCAGAGCGCGGCGGAGCTGGCAA
CTGGCGGCGAGATTCGATGCAGAAACGAGGAGAAACCACCTGGTCGAATCTTTTCCGTCGCCCGCAGCGGGAGGAAGAGCCCGAATCTCCAACGCGGACA
TTGCGCTCTCCCTCCGTCGCTTCGCCACTTCTCACGCAAGCACATCGTGCAGACTTACCTGTGGGCGCTAGTCGCAAAAGCTGCTATGTATGGCTACGCG
GAGCCGATCGGTTATTGTCTTGTGTGCTGCAAAGC