Description :
From Genome Similarity Track
Location :
Scaffold_606:16674- 19253
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_606-abinit-gene-0.23Transposase

Sequence
2579 bases(100 bases per row)
TTACACATTCTCGATGTGCTTGAAGCTGTTGTTGTCCCCACTGGCGCTGCTCTCCATGTCGGGCACGGCAGAAATCGCGTCCGTCGTACTGCTGCGGAAC
CACTCGAGCGCCAAGTCCTTGTTCTTCTGGAAGCACAGGAACGCCTCGACGAGCGCTGGGTTGCTCACGAGCGTGCTGTCGCACAAGGCGCCTTCCGTGC
GGAGCAGCACGTTGCGAACGTCGGTGCGCACAGTCTCGCCGCTGGACGACGCCGCCGGCAGCGACAGCACGATCTCTGCGTATGGCGCGATGAGCGGGAA
GCGCAGCTGGTTGTTCTTCCACCAGTTGAGAGGGTCCACGTTGCGGTCGGCGAGTGGCAGCGACAGGTACGCGGTGAGCTCTCTTTGCCACGTCACGATG
AACTCGTTGTCCTGGTGCACTCCCTCCTTCGAGCCCGACGGCAGGTGCGCGAGCAGGTCATCATCCTCATCGTCGTCGTCATGGCCGCTATCGTTCGCCG
ACTTGAGTTCGACTTTTTCCAACTCCCCAATGTTGTAAGAGCCACCAGCAGCAGATTTTTCCTCGGGCATAAACGCAAACAAGCGGCGCAAGTACGACTT
GCCGACCTCGCACTCGATCTCCGAGGACAGATAGCAGTACTCCTTGTCCTTGTACCGCGGGTCGAACAGCGTCGCCGCGTAGCAGATCGCTGGCAACGCC
GCAAACTGGTCGCGCAGCTCACGCGCAAGCTGATCAAAGAACTGCTTCCAGGCTGGCGGGTCCATGTGCGTCGGCAGACCATCCGCGACCGCCCGACGCT
CAGCGTAAATCACCAGTGCGGCTGCGAGCGTCGAGATGCTGGAGAGCCCGTTCTTGTTCACTTCCTTGTCGCTCCCTGTCTTCTTGCGCTTCTCGCCCTC
CAGCGCGTCTGAGTACCGCGCAAACGGACGCAGCTTCTTCACCATGAACCCGATCCACTCGACGACCGACATGTCGAAAAACTCGACCTCATAGTCCTGC
GAAAGCTGCTCTAGCGTCAGCAGCGTGTCCTGGAGTCCGCGGATAAAATCGTAGAACGACTCCGAGTCCAGTAAACCCGCCTTCAGGTCAAAGAATGGGT
GTTTGCTCTTGAACAGCGCAAACACTTCCTTGTTCGAGATGAACCGCTCAACGAAGGACTCGATAGCGCTCACGACCGCTGGGAAAGCCTTGCTAAACGC
GCGCTTCGTCAGCGACTGACGCAAATACGAGACCGCAGACTTGATCAGAATCGTTTCCTGCGCAGTATCTGAGGACCCCATGCGGCTATCGAGACCCACA
CCGACAAAGAGCGACGGGATGTCCGTGGCCGAGAACGCATTGCCCTCCTGGTCCACGAGAGGCAGCGTGTCCTTCACGAGCGCGATGACCTTGTCCTTGA
TATTCACGCGCTGTGTGTAGGCAAAGAGATATCAAAGTTAGCTTCGCACAGTGACGGAAATATTGTAGCGCTGGACTATGGACACATACATCGAAGTACT
GATCAAGGATCGCCTTCAGTCCGTCGACGCTGACAATGTCGTCCACTGCGATGCACCCAAGCACTGCCTCGTGCACGCGGAAGTTGACGCTGAAGTGGAC
CTTGATGGCGATGTATTGCTTCGTCTTTGGAGTACTGAAGCTCGGGATCTTCCAGGTCTCCAGCGAGATACCAACCTACAACGACAGTCGCGATTTGTCA
GTGATACCCATAACCATACATTTAATGAATGAGACGCACCAAACCAACCGATTTCGTCTTTTGCAGCAGCTCTTTCGTTGAGAGAATGATGCTCTCGTGG
AGCATCAGCACACTTTTCGCGACCACATCTTCATTTGGGACCGAAAAGCGCTTCTCACCAAACACTTGCTGCAGAAAGAACTGGAACCCTGGTTTGCTGG
CAAAGTTGAGTGGTAAGTTGTCCACCAGCGCCGTGAGCGCTGCATGTTCAAAGAAGACAATGAGGTATACAAAAGGCGTTAGTCAGCTAAGCATCAATAC
AAGGTCATCAGTATGTTAGAATTGCAACAGCGTCTTACCAAGATCTTGCGCAATCTGGTCCTGCGTGAGCGTGATCGTAGGCGGCACCCCATAGACGTTG
TAGCTCTCGCGCTGCTCTTTTACGATCATACCTGGCGCACCTGAAGCGGATGCTGGTGCAGTGGCAGCAGCAACCGGCGCTGGGAACGTAGGAAACACCA
GACCGGCGGTGTGCTTGTTGCTCTGCAGCGCAGTGAACGACGGCGACGTCCCAGCAGCAAGCGCTGCTGCCAGCTGCGGGTACACGGCCGCGAGGTCTGC
GGGGGTGACGCCTTTCTGCTTCTTCACGGCACGCTTGTTTTCGCGGTGCTCCTCGCACGTGTTGTTCGCCTGCTGGTGCGCAGCGTCCGTACGACCGGCC
GTGCGCAGGTGCGAGAGCAGGTTGGACGAATGGTGGCCCTTGATCACGCGGTCGCAGAACTTGCAGACCGAGTTGCCCATCGAGTCCTTCTCAAAGTACG
TCCAGACCGCTGACACGCTCGCCGGTCCGTTGAGCGAGAGCGACGCAGTTGCCAGTGCGGCCGAGTTCATGGCCGCGGC