Description :
From Genome Similarity Track
Location :
contig_31:166712- 169648
Transcript NameFunction/comments
g7479.t1XP_009536624.1 hypothetical protein PHYSODRAFT_565184 [Phytophthora sojae
g7480.t1hypothetical protein

Sequence
2936 bases(100 bases per row)
CGACTTCCGGTTCCCGCTGGCGCCGATCCAGGCGTTCGCCATCGGCTTGTCCTCCTGCGCCTGGAACATGAAGGCCACGACCACATAGTAACTCAAAAGC
CAGAAAGCAAGGAAGCATGTACCATACCCGAGTAGGACCAGCGACGTCGTCAGCTGCGAACTTCTCAGCCTACAACTTCAAAGTATTTTAATATGAACCA
CCTCACCGATGCATCGAAAGCGCTAAGCCGAGTGCATTTACCAAGTTAATCCTGCTTGAACTGACCAAACTCTGCTCACTGTTCTGCACCCTCGTCAACT
TGATCCGGTGTACTTTCGTCTTCATCAGCCTCGTTCGTCTCGATCTCAACGTCGTCTCCGTCGGCATCAGGCGAAGCTTCAGCGTTGTTGGATGCTGGTT
CATTCTCTTCAGGCGACGCGGCGGCCTCTTCCGGTCTCGTGGCTTCGGTGGCTGCAACATCGGCGTCATCTTTTTTATCATCGGTCGTGACGACTGTGAT
GAGTTCCGTCGCCGTGATCGCGCTCTCGACCTCGTGTCTGTGCTGGTTGTCCAGCATTGGCATGACTTTGCCCAAAGTTACTGGGTCGGGGGTAAGCGCT
CTTCGCGATCTCTTCACCAGCTTCCACGCGTCGGAGACGTGCTCCACAGCAAGGCGGTACTTCTCGTTCGCTTCAATAGCGTAAGACTTCACTGGGGCCT
GCATAGTCTCCCAGGTAAGCTTCCGCTCCCCCGCCACTCGCTCCACGTCATTCTCGTGAATCGTATCCTCTGGCCACACGCACGTGAGTTCGTGCGTGTT
GTCGATCTTGTTCCTCTGGAAGCCCAGGCCTTCATCTGGTCTGTACCTTCGAGAGACCGACATGAGGAAGGGCTCCGCAAACTCTGGCAGCATCACCACT
GGTAACTTTTCCTTTTCATGGAGGTTGTCGGTCTCCTTGGGTAGCGTCTCGCCGTCTTCCTTCGCGAGTAGTGACTGAACCAGCTCCACAGGGAACAGCG
CCGCTTGCTTCAAGAACGCCAGTATCTGGCCAAGTACGACGAGTACGAGACGGCCGAAGATCGTGTACAGCAGGAGGCCAAACGTGACTATGAAGCACAG
CACTGTCATCAGCATGACGTGAGAGTACACGATCTTGACCAAGAAACCGTACTGGCCCAGCACATCGTACTTCTGGAGCTTATCGGCCAGGATGCCGTAG
AGCTGATCGGTTGTAGCGTTGGGGTTTTCCTTCAAGACGGACGAAAGCCCCACAGATCTCAGCAGCCATGGCAAGTTCATCATTGTACCCTTCAGAATTT
CAGAGTTGCCGTACATCCACGCTGAAAAGCCCAAGTGTAGCGCCAGAGTCCAAGGCAGTACTTGGATCGTCACCTCCCCGAGAATTTCATCGTACGTCGT
CTTCACACTGTAGAGGTGCAAGATGGACAGCTTGTCGAACCAGTAGATGCCTGCACTGGTGACAGCAGCAATGAAGAGCAGCACAGGTGACCCACCGCAG
AACACCATCGTCACGAAGACCGAGTTGAGCACCATAGGGTACCGCTGTGAGATGTCGAACGTCGGACCGGCGTACAGCTTGTCCATCTTCACCTGCGTGC
GAATTGAGCGGCGCTTGTACCAGCGATAAACCGGAGACACGATGTACATTTGAGCGAACAGCGTAAACTGCGGCAGGAAAGCGTTAAGCAGCATGGTCGT
AGTGATACCCATGCCCACAGTCGGGTACCAAGCACGCTGGAAGTCTTTGTATTTGCCGCCGAGTAGCTCTTTCGCCACCGGAACAGTGCTCAAGCCGAAA
GACGCGTTCACGATGATGACGATAAGCGCGGTGTTCAGGAACTGCGCAATGAACATCCGAACTGCCACTCGGATCGTCCTGGTCGACTCGCTCGTGTGCC
GTTCAAACACCGCAAAGTAGCGCAAGATGTTGTCCAGCAAAAAGTTGACAATGACGACGATACCGGCAGCAAGAAGAATGAACGAGTTCTTGACCAGGTA
GTTCTTCGTAAATCCACGGCATGGGATGTTATTCCACAGCTTCTTGGGGCCGTCGACGAAGCCGTACTCCTTGATGCTGCTGGTCAGCGCCGTGGAGCAG
AAGCAATACAGTACGTGACTGGCGTCGTACGCCTCACAAGACATGCCATCAGACCTGACCAACTCGTTGTAGTAGAAGCAAGGAAGCGTATTACACACGT
CCGTGCTCGTCTCGGAGATGCACGGGTCTACACATCGCTCAGGGTCTGGGTAGGCGGAGCCATACGACAACCGGGTGGAGTTCAAGTCGTTCTTGATCTC
GTTGCTGTAAGCGATGTGGTAACGCGTTTCTCCTTTGGTTCCTTCAGAGCATGTCGCGGTTTCATTCCAATCCAGTGACCACAGAATCGGCCTCTTTTGA
GCATTCCAAGAGAAGGACGTGTCCGCGTAGTACACAGCCGGAAGAGAGCGGTCGCAGAGTCCTTCAGGTGGCATCTTGCTCGCAAATTGCTCCTGCGTCG
ACTGTGCGGCTGAGATGATCGCGCAGGAAATCACAAGCAGCATAACAGTAATCAAGTTCGTCACGAACTGCCGGTAGAAGCGGCCTCGATCGGTCACCTC
GAGGTTCTCCCACAGGATGTTGGACGGCTCGGGAGCGGTGGTCACGATGAGCGGGATCGTCTCGCGGAAGTGCAGTACTTGAGGCTGCCATTTGCGCGAA
AGCCAACGCGATGACTGACGGTAGTCCTGCAGGCACCGACGCCGAGACTCGAGGTTGTTGAACACGACGAAGGCACACTCGCACGCCTCCCAGTCAAACG
CTTGCTGCGTGTTCGCAGCTGCAGTCTTTGCCGTTTTCGCTGCAATCTTTGCTGCGTGTGCTGCGCTCTTGGCCGCTTTCGTTGCGGCCGCGAGCTTGTC
GTGCGCGCTTGGACTCATCGGTTCGCTTTGCTTCAT