Description :
From Genome Similarity Track
Location :
Scaffold_64:1667- 4030
Sequence
2363 bases(100 bases per row)
taaaggcatcagtactgggaactttcctcgagggaacagccagtcgtgcatactttaacttcataagtggacgagcggtacgctacgatgagctcactgc
acacctgaagaaggaatttggctgtagccttactcagtacgagcttggaaagcgcatggacacgcacaaacggtccggagacacgtggaagcagtacgtc
acctacctgaagttcatcgagcgtttgatggttggagacaggtcgcagttgctactagaaaccgtgtgcaacaatgcgtgccccgagttgacgtctacgc
tcctgagcaagatcgcatgaaaacaactacaactatatggaggagctggacaagatcgttgagttcctgattcgctgcaagggtgatggccgccgtgtag
gcagcacaaagcagcgtggacaaccaaatggccacatcatcaagccaaacagtcagcaacagggaggcaacgcgcaagaccagaagcttcggcaaaacaa
cacccagcagcagaacaagaagaagatcacgcccggcgcacaggctaacagcacggagaaggcgttcacgtttaagtgctggaattgtggggaaactggc
cacaaccgcgagaactgcacgaagccaaagaaggacaccaagaaggacggcgatcctggtgaagccaatcaagtgcagaacaactcctcctgtacgcaag
atgatggcgcgaaggtggagttgtgggtcgctgctgaacaagaaacgggggtgccagtacgcagcacgagttggctgattgactctggagctaccgacct
catgtgctgcgatgaaactgctctttttggtacttcgccatcaaacttggtgatcaaggtagcaaacggcggaattgtgcgggcggagtacaagggaagt
tgtctcttgaaggtttccgatggcgctaatacacgccacgtgatcatgcatgaagtgcattatgtcccaggcctcgctcgcaacttgatgtcagtcatgg
tacttgctgaaaatggcatcactaccacgttcagcccggtaggatgcagcctacgagacaagggtggcaagacaattgctatcgcggaacgtcaaggaaa
gacgtgtctgctgaaaggcgaagcggtggaccctgatacaggtggagaggccatgtttgttcaggttaccaagtcgacgttccagcactggcacgaacga
ttggggtacattaactttcaggatctgctgcgcatgtacacaaaggggctaactggagacatggaggtcgtctccaagaagttgcgtttctgtttgtctt
gtgcagaagccaagcagaccaagtcaaagcaaccaacaactgacacatcaacatcagcgcctacggatcaggtcggcgcagtacttggggtggatctcaa
gccagatattccggcggacaggaatggcaacaagcacgtactaagtatcgtgaattatggctcgtccttcaatcgggtttatctattgaagacgaagggc
gaagcagccgccaagctgatgtccttcatacccgagtttgagcggcaacatgatgtagtggtgaaggtgattcgttcagacggcggtggagagttccagg
gccgcgagtttgttgcgttctgtgagcgacacgggattaaacagcagcagacactccccgacaactcggcatcgaatggcaaggtcgaacgcttgcatcg
gactctaatggattcgggccgtgcaatgctgtgggcatcaggactaccagaacgttactggggtgacgctgcaaagtacgcatcgtacatccggaacaga
cttccgacaagagcaaacgctaacggcaagtcgccgatggaaatactcactggtaagccgcctaacgtgggacacattttacgttttggatcaacgcgca
ccacccacattgctcacaagaaagcagcttcagtgaagcgccgagcggaaaagggcgtggggatcggcatcagtgaagaacagaaaggatatcggcttat
cataccgcgcacacggaagatcgtagtgagtgctgacattcagaatatcgacaaactggttgtgaacgagccagaaaccaaaaagactctgaatcagctc
cacggtgaagatgagccggagcctgctgcccccacaagcgaaccacagagtcataccgagccacaacagtttcagaccaacaaggactcgcctcgaagca
aacttaagagacgcaggagccctcggttaaaacacatcaaggcggccgacgatacaggtgtgtcaagtgatagtggggaggacgagtatgccggaaatcc
catcagcgcaggtacccttcgtcgggtttttggctctcgcaagaggatgaaacccgctgagtt