Description :
From Genome Similarity Track
Location :
Scaffold_889:1667- 3934
Transcript NameFunction/comments
g16694.t1hypothetical protein
g16695.t1OWZ00441.1 reverse transcriptase, partial [Phytophthora megakarya

Sequence
2267 bases(100 bases per row)
CCCACGCCTTCCCATAAGTTCTGCACTTCGAAACTCGGATCCGTTCTTGGCCGCCTTCTGGGAAGAGCGACGTCAGCGGCGATCTCGTCTTGGTGCCCGC
TGGAAATCGTTCTTGCGACACGTTCTCCGCGGGATGGCCGACGGCCATTGCGATCTAGATCTGCTCCTTGATCCCTTTTCCCTGCATTTTCCCCGGCTCG
GCGAGAAAAGAGTGTGGTATCCCGGCTTGGGATGTTCCCCACGACCCTCGACCTTGGTCGATGCTCTTCGCGCGATTGACTTGGAGGAGCCGTGGCGTAA
CCAGTACCGCGACAACCTTTCCGACCACCCTAGTTCTCTCCTTCCGCGGCTTACCGCCAAATTTTGTCGTCCGGCGACCGGGAATTAGGAAATCGTGCTT
AGCTATCCCGTAACCCTTTAGCAAGATCACATGATCTCATTCATCTCGGCATCTGCGTTATTTCTTCATCGATGTTCCTTGCTTATGAAGCTCTGGGTTC
TACCATGAAAACAGGGTAGCTTTGCCCCAGGCCATACGTCACTCCACAATTAACCCTTCCTCCTCGATGTGCGGCATCCCCGCACATCTTTCTTCACATC
TTCCGCCCGCAACAGCCAACCTGTTACGAGCCCTCCTCCTCCGCCTCATGCGACTGCATGACTCCGAATCGGTTGCGGTTAGTTACCTCACGTTCGTACT
CACGCAACAATGCTCCGCAGTTGAGATCGGCCTCGTCGACCCACGATGGATCTTCGTAGCCCTTCCAATACACTTGGAACTCTCGGTGAACTCGCCCATA
AGGCGTACGCCGCCCTGATCGCACATCCGCAATCCTGGCAACCTCGTATTCGCCTTCGTCAAGGCTGCGATCCCAATTGTCTTCTGGCAGGATCGCTTCT
TCAAAATCGAAACGATCGCCTTCGGCCACGGTAAGCGCCAATGTAGGGCGATCGGGAAAACTTCGCACCAGCTTGAGCATGGACACGTGAACGATCGGGA
ATAAGCGGTACTCCGTGCCGGCACTCTCCAGTCTCGCTGCGTGATTGCCTACCATCTCGACTACCCGGAACGGGCCGTGCCACATATGCGCTAGTTTTCT
CGCGTAGCCTTCCTTCACCCGGTCTAGATACAACCAGACGTGTGCGCCAGCCTCAGTCTCCTGGGATCGGGCGTTCTGGTTGTGTTCGTCGGCCCGCGAT
TGGATCGCTTCCCGGAGCCGCTCATTTACCTGCTCCTTTGCCCGTCGATATTGACTCTGCATGTGGAATCGCCATCGTCGTGACTCGCGATCACGCCGGT
GCGTGCTCCCGACGGGTAGCGCCGCTTCCAGCGTGGATCGTGGACCCCATCCGTGGATTAGATACAACGGCGTGTCTCCACGAACACGATCCTGGGCCGT
GTTGATTGCGAATGTGAGGCGTTCTGCGTACTAGTCCCAGTCCTGTTGGTTAACGTCTGCGACGTACATCTTCAACGCTCGAGTCAACGTCTGCACCATA
CGCTCGGCTGTTCCGTTTGCCTGGGGCCGGTACGCCATCGTGGCTCTCTGTTTTTGTCCCACGATCCGGCTGAATGCACGGAAGAAATCAGACATAAAAC
CGGGTTCTCTGTCGTGACGGATGGCTTCACTGGCTCCAAAACGGCGGAATACGCACTCTTCATAATTCTCCGCGATCGTCTGGGCCGTCCGTGACGCACT
TGCTTTCGCGATCACATATCCCGAGAACAGGTCTACCCAGATCAGCAGCTCCGTGTTGCCTTTGAAAGACTTGGGCAGCGACGGGATGTGGTCCATGGTG
ACGATCTGGAACGGGTACGTAGCTTGCAAATTTCCAGGGGACTCCCCTCTCACGAAGGGTCGCCCTTTCCCTGTCTCACAGTCTGTGCATTCTCCCACGT
AGTGTTGGACACTTCGGTACAGGCCTCTCCAGTAAAAATGCGATCGGATTCGTCGGTACGTTCTTCCGATCCCCCGATGCCCTCCTTCCAGACTCGCATG
ATAGTGATGTAAGAAATCTTGTTGCAGAGTCTCTGGGACCACCAACTTTGCGATCTCATCCCGACCCTCGTCCTGCTTCATGGATGATGGACAATAGAGC
AACAAGTCGCTCTCGTCCAGCTCGTAATCGTCCGCGATCTTGGCACACGACTTGGCTTCCTTCGCCGTCAAGCTACCGACGTCTCCCTTCAGGTACGCCT
TTAGGTCGGTGATCCATTTCTCCTCATTCTGGGCTTGGACGACTCGCTCACTTCGCATGCGCTGAAC