Description :
From Genome Similarity Track
Location :
Scaffold_483:1667- 3435
Transcript NameFunction/comments
g13067.t1hypothetical protein

Sequence
1768 bases(100 bases per row)
TCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGGATGT
CCTCCATCAGGACATTTCCGGGATGTCCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATTCGAAAATGA
ACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGAGGGCGGGAAG
ACGCCCCGGGTTTGGTCAACCAAACTTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCCGCTCTGCGTCAGGAGCTGAGCTTG
TTGAAGGCTCAGCTCGCGGAAGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGGCTCTCTGCCGCCTTGAAGTGCGTCGCCGCGCTCG
AGAGCGCTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGT
ATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTT
TAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCTCTGCCGGTGTTATCGGCGTTCAGCTTCTGTCGATCGAC
AGAAGCTGCTATCGCGTCCTGGACAAACCGAATTACGACTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCC
TTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACATTGTCTTGTCGTCGCCATGACTGCGCGCAG
TACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGC
TACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAAC
TCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGG
TCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACAC
GATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACC
ATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAACCAAAGTCCATTGAAATGGACTGCCAGCACT
CCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGACATACCTCGCAAGCACGAACGTACTTGCGTACCCATTT
GTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGTCCCG