Description :
From Genome Similarity Track
Location :
contig_31:166699- 169635
Transcript NameFunction/comments
g7134.t1XP_009536624.1 hypothetical protein PHYSODRAFT_565184 [Phytophthora sojae
g7135.t1hypothetical protein

Sequence
2936 bases(100 bases per row)
CAGTTTGGCAAGTTCTCCAAGTCCAAGTTCGCGCTCGACTTCCGGTTCCCGCTGGCGCCGATCCAGGCGTTCGCCATCGGCTTGTCCTCCTGCGCCTGGA
ACATGAAGGCCACGACCACATAGTAACTCAAAAGCCAGAAAGCAAGGAAGCATGTACCATACCCGAGTAGGACCAGCGACGTCGTCAGCTGCGAACTTCT
CAGCCTACAACTTCAAAGTATTTTAATATGAACCACCTCACCGATGCATCGAAAGCGCTAAGCCGAGTGCATTTACCAAGTTAATCCTGCTTGAACTGAC
CAAACTCTGCTCACTGTTCTGCACCCTCGTCAACTTGATCCGGTGTACTTTCGTCTTCATCAGCCTCGTTCGTCTCGATCTCAACGTCGTCTCCGTCGGC
ATCAGGCGAAGCTTCAGCGTTGTTGGATGCTGGTTCATTCTCTTCAGGCGACGCGGCGGCCTCTTCCGGTCTCGTGGCTTCGGTGGCTGCAACATCGGCG
TCATCTTTTTTATCATCGGTCGTGACGACTGTGATGAGTTCCGTCGCCGTGATCGCGCTCTCGACCTCGTGTCTGTGCTGGTTGTCCAGCATTGGCATGA
CTTTGCCCAAAGTTACTGGGTCGGGGGTAAGCGCTCTTCGCGATCTCTTCACCAGCTTCCACGCGTCGGAGACGTGCTCCACAGCAAGGCGGTACTTCTC
GTTCGCTTCAATAGCGTAAGACTTCACTGGGGCCTGCATAGTCTCCCAGGTAAGCTTCCGCTCCCCCGCCACTCGCTCCACGTCATTCTCGTGAATCGTA
TCCTCTGGCCACACGCACGTGAGTTCGTGCGTGTTGTCGATCTTGTTCCTCTGGAAGCCCAGGCCTTCATCTGGTCTGTACCTTCGAGAGACCGACATGA
GGAAGGGCTCCGCAAACTCTGGCAGCATCACCACTGGTAACTTTTCCTTTTCATGGAGGTTGTCGGTCTCCTTGGGTAGCGTCTCGCCGTCTTCCTTCGC
GAGTAGTGACTGAACCAGCTCCACAGGGAACAGCGCCGCTTGCTTCAAGAACGCCAGTATCTGGCCAAGTACGACGAGTACGAGACGGCCGAAGATCGTG
TACAGCAGGAGGCCAAACGTGACTATGAAGCACAGCACTGTCATCAGCATGACGTGAGAGTACACGATCTTGACCAAGAAACCGTACTGGCCCAGCACAT
CGTACTTCTGGAGCTTATCGGCCAGGATGCCGTAGAGCTGATCGGTTGTAGCGTTGGGGTTTTCCTTCAAGACGGACGAAAGCCCCACAGATCTCAGCAG
CCATGGCAAGTTCATCATTGTACCCTTCAGAATTTCAGAGTTGCCGTACATCCACGCTGAAAAGCCCAAGTGTAGCGCCAGAGTCCAAGGCAGTACTTGG
ATCGTCACCTCCCCGAGAATTTCATCGTACGTCGTCTTCACACTGTAGAGGTGCAAGATGGACAGCTTGTCGAACCAGTAGATGCCTGCACTGGTGACAG
CAGCAATGAAGAGCAGCACAGGTGACCCACCGCAGAACACCATCGTCACGAAGACCGAGTTGAGCACCATAGGGTACCGCTGTGAGATGTCGAACGTCGG
ACCGGCGTACAGCTTGTCCATCTTCACCTGCGTGCGAATTGAGCGGCGCTTGTACCAGCGATAAACCGGAGACACGATGTACATTTGAGCGAACAGCGTA
AACTGCGGCAGGAAAGCGTTAAGCAGCATGGTCGTAGTGATACCCATGCCCACAGTCGGGTACCAAGCACGCTGGAAGTCTTTGTATTTGCCGCCGAGTA
GCTCTTTCGCCACCGGAACAGTGCTCAAGCCGAAAGACGCGTTCACGATGATGACGATAAGCGCGGTGTTCAGGAACTGCGCAATGAACATCCGAACTGC
CACTCGGATCGTCCTGGTCGACTCGCTCGTGTGCCGTTCAAACACCGCAAAGTAGCGCAAGATGTTGTCCAGCAAAAAGTTGACAATGACGACGATACCG
GCAGCAAGAAGAATGAACGAGTTCTTGACCAGGTAGTTCTTCGTAAATCCACGGCATGGGATGTTATTCCACAGCTTCTTGGGGCCGTCGACGAAGCCGT
ACTCCTTGATGCTGCTGGTCAGCGCCGTGGAGCAGAAGCAATACAGTACGTGACTGGCGTCGTACGCCTCACAAGACATGCCATCAGACCTGACCAACTC
GTTGTAGTAGAAGCAAGGAAGCGTATTACACACGTCCGTGCTCGTCTCGGAGATGCACGGGTCTACACATCGCTCAGGGTCTGGGTAGGCGGAGCCATAC
GACAACCGGGTGGAGTTCAAGTCGTTCTTGATCTCGTTGCTGTAAGCGATGTGGTAACGCGTTTCTCCTTTGGTTCCTTCAGAGCATGTCGCGGTTTCAT
TCCAATCCAGTGACCACAGAATCGGCCTCTTTTGAGCATTCCAAGAGAAGGACGTGTCCGCGTAGTACACAGCCGGAAGAGAGCGGTCGCAGAGTCCTTC
AGGTGGCATCTTGCTCGCAAATTGCTCCTGCGTCGACTGTGCGGCTGAGATGATCGCGCAGGAAATCACAAGCAGCATAACAGTAATCAAGTTCGTCACG
AACTGCCGGTAGAAGCGGCCTCGATCGGTCACCTCGAGGTTCTCCCACAGGATGTTGGACGGCTCGGGAGCGGTGGTCACGATGAGCGGGATCGTCTCGC
GGAAGTGCAGTACTTGAGGCTGCCATTTGCGCGAAAGCCAACGCGATGACTGACGGTAGTCCTGCAGGCACCGACGCCGAGACTCGAGGTTGTTGAACAC
GACGAAGGCACACTCGCACGCCTCCCAGTCAAACGCTTGCTGCGTGTTCGCAGCTGCAGTCTTTGCCGTTTTCGCTGCAATCTTTGCTGCGTGTGCTGCG
CTCTTGGCCGCTTTCGTTGCGGCCGCGAGCTTGTCG