Description :
From Genome Similarity Track
Location :
Scaffold_15:166685- 174515
Sequence
7830 bases(100 bases per row)
AGGGAGTGAAAGTGATTAACAGATTGGAGTTGTGAATGGTGCTAATTGTGGTGCTGAAGATGGCCAAGTCACTACGGACAATGAACTTCTGGATTGCGAG
CAGACGTTCTCGAAACAGATGTGGGTGTAATTTTTTGTCGGAGTAATGATTGTACCTCTGATAATGAAGAAGAAGTTGGAAGTTCGGATCCTAAAGACGA
TGACATTTGTGAGCTCCTGCACCCGTCCGATGGAATCGCAGGACTTCCCAGATTTTGCTTCAGGATCGTTCTCTTCTCTGTCCTCGCAGCCTGAGCGCGT
TTCAGCTCGTCAATCGCATTTTCGTGATCACCATTTCAGATCGCAGGTGAACTGCTGGGCCGGCTGGATAGCTTGCTTCAACTCATATTGAGCGTTGCCA
ATTTGCATCTTAGTCGTTTTGGTGAAATCCTCAAAATATGGCATTTCCTCTGTTAGTTGGACTAACCTATGCTCGGCTTTTCGAACCTGAATCCCGAGCT
GGCTTGGTTGTGGTAGCAATGTGCTGCTGTAGCAGCTTCTCGAGTTCTTAAAATCTTTGCTAGCGTTGGAAGCATCAGCCAACGCATGCGCGAACACGAC
ACAAATTTCTTCATGTGTTCACTTCACCTTCAGCTTCATCTCCTTAAACCTTGCGCCTCTATCAACAAGTTCTCCGTCAAATGTCTAGCTTCCTTTGTGA
CCAGCAGAGCTGCTCTTGAATCTGTAAGTTGACTTTCAAGTGCTGCTTTCTTTGTTGCCACTTTAGTGGTAACTCTTTCAAACCTTAACTGAATGGCGAG
AACGAATCTAGCTTCACTTTGCCTACTCCTCTATTAATCATGCAGAGAAATTCGCATCTTCAACTCCATGTGAGACGTTCCCTTCTATGTTTTTGATCGT
GATACGACTGATTCACGAGCAACTGGCCATGTAGATAACGCATGACATTCAAGTGAAGAATACGCTAATTTAACTTCGTACAGGTACCTGGAGGGTTCTG
CTCAAAGCTGTAGAAAAACGTATACGAATGTTGCAACTTGCCATCCTTCTCGGCAGTTACCGCGCGGGCGTAAAGAGAGAGCAACAGAAACACCTCTTGC
TAAAGCAAAATTGACGAAACAACCACATGGTTGCGATAGCAAACTCAACATTAACGCTAGGGCTTAAAATGAGATTGATATGCGGACTCAGCGAAAGATA
TCATCGTCGTAGCGGTGAACAGGTGGGAGGCGTAGCACATCGTATAAAAACCGCGTTTTACGACGACTAATCATTGCGAACGCAACTTCAAACTCTTATA
TAGGAATTCAATCGGATTCTTGGTAGAAGTGACAATGCTGTCTGCAATTGCAATCGGTTAAGAGCTGCTTTCTTTGATAGATTGAACAGCAATGATCCAA
ATCACACGAAGGATTTTGCTATCCAGAACCGCTATACGTACAAAGTACTGTTCTTCAACGTTTCCACATTCTCCATCTGCAAAATTGGAATTGCTGACGA
TATTCATCACCATAAGGCTCTTTGTAACAGCTGCTAAGAACACCAGGAAGCATGCAACTAGTTGCGATTGCAAGACCTCGTATGTATNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGATGTTTTTTGCTATCTGCCC
TTTTTTCTTGTTCGCCTTTGATGTGCGTTTATGCATGTCTGCTAGCGCCGCTTGTAGCGTAGCAATGTTCTCACTCCTGCTGCGCTTAATTTCATCCAGT
GTAGTCACCTGTATCGGCTCGGGCACCGCAATGGGGTCCGTGGGGTTCATGGCCCTTAACCCCGTCTTGGCTGCCACAGGGGCCACTCCATCAATAGCAG
AGCAGAGAGAATGGTTCAAGACCATTTGCACAATTTTGATTACGCGAAGCCAGTCTGTCGGCTGCAGTCGCCACTCGGACAGCAGTGCCCGGCAGCACCG
CAGAATCTCACGGTTTACGACCTCCACTGTGCCGTTTGCCCACGGGCAACGAGCTGTCGTAAAGTGATGATGAGATCCCATTGCTTATTCCATCGATTAC
CTTGTTCTTGAAGTGGGTACCTTGGTCACTCACCCAGAAGCGGCACACACCGAAACATCCAAACCAATCCATGAGAAAGTCAAAAGTGTTGTCAGCCGTT
GCTGCATCTGTAGGCATCAATCAGACAAATTTCGATGCATCGTTTTTTTTTATAACCAACACATATTGCAAGTCTGAGTCACTTTTTCCGATGTACAGGT
AATCCCAATGGATCAGCTCATTGGGCTTATCACCTCGACAGCTTCTCCAAATGGGCGTGACAGTGGTGGAACACCAGTCGAACTCGCAGAGTGCAAGCAA
CGTCTCACAAAAAACACGACGTCCTCCTTCAAGCTCTTCCAATAGAGCTTAGCAGAAATCGCTGAGAAAGTCACCTCCGAAGCACGGTGCCCCGCTACGC
CAAAATGCCCCACGACATATGCTGAGCTCTAGCTCCGACATCTTCTCCGGGATCCAGATCTTGTCACCCTTCACTAGTCAGATGCTGTTGTCGTCCGACT
TATGGGCTCCCTCAGGCAGTGACGCACTCTCCTGTGCGCGTTGAAACTCCTCAAGTGAAGGCCACACAAACTCCGCATCCAACTGCGGCGATAAAGGCAT
TTGCAGATGTCTTATTGCACTGATAGTTAGAAACGTCGAGCCCCACCTTGATAGTAAGTCGGCCCACACGTTATCATCTCCTGCAATATCAAAGATGTCG
TAGCGATAAGCCATCAGCAGTAGAGACCAGCGATGAAGTTTGTCGGCCGTGTACTTGGGTACTGCACTGGACACTCCATGCGGGTCGAAAATGTACCTCA
AATTTCGATGATCGGTGAAAAGAGCGAACCCATCCGCACGGTGCACGCCGGCAACTCTCCACTATCGCATAGGCTGCTTTCTCAACTATAGCCCAACGCT
TAGCTGATCCCGAGAAAGTCCCGCTTAGCATCATTAACGGTTGGTGTTCTTGCTCGCCAAGGGGCTGGTGCTGCTGGTCAAGCAGTATTTGAGTCACTGC
TGCACTCCAGTGCAGGTCGCTGGCTTCCGTGAAGATGCACAAACGCTTGGCTGGGTCCGGGTGCGCCAGCTGCAACGCCTTGCTCAATGTCGTCTTACAA
CGCTCAAAATACTCTTGATGTTCATGGCCCCAGCCAACATCACTTAAAGCAACCTTGCGCACAAGTTGCTTTTTCCGACCACCCGCTTTCTTGTAGATTT
CTTCCACGAGTTGTACTAGCGGATGCACTAACTTATTGTACGCTGGTAGTGAGCTGCGCATCCAATTCAATGCGCATATAAACTGCTGCAATTCATTCCC
TGTCGACGGAGGTGGCAATCGCACCAGTGCCTCAAAGCGGGCGGGGTCGTAACGCACACCCTCGCCCGACACCACGCGCCCGCACCACAGTTCCTCACGC
AAGTAAAAAAGCGTACTTCGACGAGTTCAGCTTCAGCCCTTTGTCCGCACAAATTTCCAGCACTTTTACCAGCAACTGCAACAGACCCACATCATCCTTC
TCGTATCCCAAGGGATCCTCTATCCAGATGAGAAGCCCGTTGTTAAACACCTCCGCGAACATTGCTTGCACGGTCGAATGCACATGTGCCACGCTGTTCG
TTCCTCCCATGTGAACGCGCGTGGGCGTGACCACTCCGTCCTCAGTTAGAATAGAGTAAATCTCCGGGTAGTGCACCGCCATGACGAATTGGAAAATTCC
CTTAAAGAAATCTAGCGAGAAGTAACGGGACGATCCGCGTAGGCGATCAAATTCCACCTCAAGAATCGGTATTGGCCACACGACCTTTTCAACTTTCTCA
TTTGCTAGTTTTACATCCACAGTCATCCTGAAATTTCCCACTCCAGGCTTCCGCACCACGTGCGGAGGTGAGCACCACTTACTCTGAGAGTTCCTGTAAC
ACAAGCCAGCTTCCAGCAATTCACGTATATGCTTCTTCAAGAACTCACGGTGCTCTGGTGAGTTGCGCCGAGCCCAGCACCGTACTGGAACTGCGCCAGG
TTTCAGTGTTATTTCCATCGCAGGCATGTCAACGGGTGGATCCCTCCCGATTTTCAGTCTGAACACGTCTTTGAACTTCACTAGCACGACTCGCAGTTGC
TCTACATACTCGCGGGACGCCCCCTCTTCTTTAACTTCCGCAAGCTTCTCTTCCAGAACCGCAGCCACTTCATCATCTTCCGATCGGGTTGCACCGTCGA
AACTTGGAAAACACGCACGGTCTTTGTCGTCGTGCAGTTGGGTTTTCTCTACTGTCGGCTCGATCGCCGAAGGCGCTTCAGAGTACGCAAGAACCTTTGA
GAGACCCAGTTCACAATCGTCTTCAACATCCCCCATATCCCAAATTTCCTGCAAACTCTGAGCTGCTGCAATCAATGTTTTCGAGCTGTAGCCTAGATGC
TCCATGATGTAATACGAGAGCAATGAATCGCCAACTCCAGCCGGAAGACTGTCCTCCGTGACCCAACAGTTTACGGTCCTCAAAATCAAGGGTTCTCCTG
GAGTCGTAAAACGCAGATCTAGCTTCACTTTGGTCCTAACAGAAACGGTCTTATCCCCTACGCCGGTCACGCCTGATGGCTTTGCCAAAGGCTGCATCTC
CACCTCTCCTCCGGCCGACTTCAAGTCGTTAATCAATTTCATTGTCACTAGAGACACGGAGGCAGCACTGTCGGGAGTGATTAAAGTCTCCACAGCTCCC
ATCACCAGGCACGGAATCGATGCAGACGTCTCCTGCGTTGTTCCCCCGGTAGTGGCTACCAAAACGGGCTTCATCACCTTTTTTCCAGTGCTCTTCTCGT
ATATTTCCTTCGCCTCCAGTAGACTAGCAATGTTCGGGCATGGGAAAACACCATGGGTCGGATCGCCACACTTAAAACACGTTTTGTCTGGTTTTTCTGT
CTTCGATGGCGCTGGAGGCCTCGCTTTGTACGACACCGTCGCCGGCTTAGCTTCACTCGACGTGGCCTTACCTTCTCCAGTTCCTCGCGGGCCCTTCTTT
CCCGGTCCGGTCGATGCAGATGACGGCGGAAAATTAGTACTGCTCTATGGTGCTGCGTGCACCGCGATGTGAGCCTCGAATCGCATGAACCCCTCCAGCT
CAACCCGAAGCCACTTCAAGAATGCTTGAATACTCGACTTAGTCGCCTTGTGGATCTGACGCCCCAACTGATCTTTCACAGTCGCTTTAAATGCTGGTGG
TCGTAGAGCCTCCACTAAATATCCGATAACTTTCTTTGGTTCTGTTTGAATCACGTCTTCCATGTTTAATCGATCCACGATAGTGTATAATCTGCCATGA
GGCGCAAAAGACGTGATTCAGCATCCTGCAATTCAATATTCATGCAAAGACTTTTCACTTCTCTCTCCAGGGTCTTGTACACAGTGTGATCTGGGATGTG
AGCGGACAAAAAGTAGTTCTTCCATTCCCTTTCTGTAACATCTCTCTCATCCTTGAATAATTCAAAGCCACAAATGCGCACCATCGTGCTCTGCTCGATG
CAGGCACTAAGAGGCATCACAAATATGCTCGCTTGTGTGCCTTGGTTTAAAGCTTTAATGCGACGTGTAGAGATGGCGTAACTATCCATGAAGTCATGCT
TCTCCTTCTTAGAGCTGCCTCGGTATATCGGGGGTACCGGCTGGCTGGTTCCAGCAGCTACTGTGACAGGCGTCTCAGAGCTGCGGTTCCCCGATGGAGG
TGCTGCTCCTTGCTCGAACGCACCCCAGCGCGCTTGAAGATGAGGCTGCACCGCCTCTACTAGGCTCTCCAGACGCTTCCCCTGTAGACCCACAGCTTCT
TCAGCCGCTTTCAACAACCGGAACTGTTCTTCTAGGAATCGCCGGTGCTCTTCCGTTTGTTGCATTATATCTTGCTGCTGCTCGTGCATGGCCGACTGAC
GGTCGTGCTGTTGCTGAAGATATTCCGATGTCTTGGCCGCCAGATGCTCCTGCTGGCGCTCACTTGCCCAAGCTGCTCGCCAGTCATTTGCTGCACGGCC
GCTGAGTGCTGGGCCAGTGCTTCAACTTGGCGGTGTGTTTCCCCAACCTGCATTACTGCCATTCGTGTCGTTGTTTCCCGGGTCAACGTCAATTCCCGAT
CTGTATTAGGTGATAGAGGCGGGTACACCGCAATCGGCATCCCCGTCCCAGAGTGAGGCACCATTGCCTCGTCGGACTCCTCCATGCTGGGAGCGACTCC
CCAGCTAAAGCATTCTTTGTTGTTTGTCACCCTTGATCAACTGTAGAAGTGAGTATATTAGCTTAGCCTGCGATCGACTACAACTCGTGGTTACTCTATG
CATGCTTCGTTTGTTTCAAAACCCATGCGCCGTGGCTTCTGGGGCTGCAACCCCCGCTGCTATGGCGCTTGTTAGCGCTTGCCCCGCTCAACACTGTGTT
CAGAAAATCGTATCTGCTTTCGATTTGCTATCTCATCAGTCAGCGGAAAAGATTTGTGCGACTGTAGCAACTACTGTGACCGTTATAAAAGCCGAGACCC
GACAGAATTAGACAAGTGAATGGTAATCAC