Description :
From Genome Similarity Track
Location :
Scaffold_39:16666- 20729
Sequence
4063 bases(100 bases per row)
CCCAAGTAGGCTCATCGTAGCCGACCCACTTAACCTAAAACTTTCGCTGGGACCGGGACGTACTCGTGTATAGTGGTAACTCGTTGTCGCGGATTGCCTC
GAATTCATGCTGGTTCGTACTTGCGTCTGGTTCCCAGCTATCTTCGGGTAGTAATTCTTCGTCAAAGTCAAATCGCTGAGTTTCTTCGAGGTCGACGATT
AGCCTCGTCTTTGGTCTTCCGCCCACTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGAAAAAAAACCTGTATCCACTCTTGTCGGGTAACTCC
AATTCATAGGCGAATTCTTCCAACTTCTTCTTCACCCTGAATGGTCCATGCCATCGATGGGCTAACTTCTAGGTCAGGCCCGAGTTGACTCGCTCCATAA
ACAACCAGACTTGATCTCCTTCTTTGAACAAGGATTCGGTGGATTCATCGCCTGGTTCTGCAACTCCATCTTCGTCATCTGCTGTGTTGGGGATGGATCT
TTTCTCCTTCTTGCTCAGTGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGGGCAACTTCTCGTTGT
CTGTACGCTTCTCGGTGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAGCTCGTCATAGCCTTGAGTGTAGACTTGG
CGTCCCAACCATGTATCAGATGGAAAGGGGTTTCTCGCCGAGTCGAGTCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGTC
GGCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAGCCATTGTCTTGACTGACCTCTTTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAGCGTA
GCTCTTGATCTCGACTGCATCATCTCGGAGAACGTTTGGAATACTTCACTCATAAACCTTGGATCTCGGTCGAGCCGTATCAGAGACGGAGCCCCGAACT
GCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCCCCGGTGTCATCCATAGCCTTAGCGATAACGAGCCCGTGAAGTGGTCCTGGAACAGC
AGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGTAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAGT
AACCTCTCAACTACGGCTTGCTCTTACCGGTATTGCAGTCCTCGCAGGTCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTAGTAGTCGGC
TTTGACTCGGTGATAAGTTCTGACGATACCTTGATGACCTCCTTCGATCGAGTTGTGACAGTTATGAAGTATCTCGTCGACCGTAGTTGACGAAATCACC
AATCTCATTGAGAGGTTCGGTTCGCCGAGCTCGCCCAGTCGGCGAGTTTCATCTCGGCGGTATAACAGGTCGTCTTCGCTGAGTACAAAGACTTCTGCGA
CTTTGCCTGCATTCTGAGCTCGACGGTGCGTAAGGTCCTCAAATTCACCTCTCAGGTACGCCTTCAGATCGGCCCACCTGAGTTCTTCATCTTGTGCCTT
CGCGATTCGTCGTCTCCGCTCAGTCTGTGCTGTCATGGATCAATGTCGTTGTCATTCTGAGCTGTCTGGGCTGACTCCACCTGCGACCCTGTTTCGGCAT
TCGGGGTCGTGTGGTTAGTCCGTCGAGTCGACGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCTTTCAAACGCAGATTCTCCAGGATTTGTCGATAT
GGCTTCGTGATCCTGACTTCCTCCTCTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAACCCGGCGTACTCGGCTACGAGTGACTGCCGTG
ACAATCGGGGTTTCCGCTGGGTTGTCAGTGGCGTACAGTTCTTCGACTACTCGGTTAATCATTCTCAGTTCTGCTTTCCTATCCGCCCCGAGGATTACTC
GTCCAGCTTTAGCTTTAAGTGCTTCTGTAGCGAGAGAATCAGCCGCTTCGTTATAGTGTCGCGCTATGTGTCGATACCAGACCGAGTTGAGTTGCTTCGT
TAGATCCTTGGGTCGAGCTTGCTCCACTTGCAACGTTTCTTTCTTGCATGCTATCACCCCCATGGATTGCTGGATTGCAAGCCGGGAGTCACCCACGATA
ATCAGATCAGTTATCCCTCGGTCAATCACCGCCAAGACTCCATTGTTCATGCCGGCGTACTCGGTGATGTTGACTGTGGTGGACGACAGGTACGCACTCG
CAGCGATCTCAATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAACTTCCATACCCGTCGTATTTAGCTGTCTTCGCTGAGCCATCAAATGACAG
TACACATCCCGCAAAGTCAGCTGGTATTCGGGCGTATAGCAGCTCTGTGTCCATTCGAACTTTCGCCGAGTTCTTGGAGGGAGGCGCAAGGTGCTTCAAG
GAATCGTCGAGTCCGATAAACGGGGTTATCGACGCCTGGAGCAACTGGGCGAAGTCTACATCTCGTTCGCGTACTCGCTTCACCTTCAAATCGTAGGGTA
AAAACATAACTACGAAACTGACTGCGCGGCCGTACAGCGAATTTGACTTAAACACCGACTCCAGCGTGGCGAAACGGGTGTAGACGTGTATCGTCTTTCC
CGCCAAGAGTGTGTAGCACACTTTCAGCAATTGCAACAGCGCGACCACTTCTTTCTCAGCGGGATGATAGCCGAGTTCATTCTCCTTTAGCACGCGTCCG
CAAAAGCGAACTCGGCGCAGCTTGTCGTCATGCGGCTGCATCATAGCACTGCTCAGTGCCCAGTCATTAGCGTACAACATGATGTGTACTTCTTTCGCCG
AGTCGAAATTGGAGCTTCCGCTACCCGTTTGTTTTAGCTCGTCGAATGACGCTTTTGCTGACGTCAAGTCATCCCAGGACCAAAGTTCGCCTCCTTCAGT
TGGTAGAGTACTGCTCCATAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTATGTGCACCTAGGAAGGCTTGCATCCCTTTCTTTGGTTTTGGGA
AGGAGGGCTCGGCGATCGCGGCTATCTTCTTCGCATCGGCGCGTATACAACTCGGCGTAATCTCATGCGACAGAAAATCGACCTTGAATTGGACGAAAAT
ACTCTTGGTAAAAATGATGCTAATATGACACTCTGTGAACCGGGCTAGTAGTCGGTTCAGTGTCTTTAGGCAGGCGTTAAACGTCTCCTCTCCAAAACAA
ATATCATCGACAAACATTTTCCGCTTGAACACTGGGATCAGATTAGACTGGTCAGGCTCTCCATTAGCGAACATGTTGCCGTCCGGTCCGTTGACCAGGT
CTTGGACTGGATCGCAGTCAGCTTGTGATTGGTGGTCCGCTTCGAACTTCGTCAGCTGTCCTGGCGCTGAGTCGCCGTCTCCGCCGAGCACGAATCGCCG
AGCTCCCGACTCGGCTTCAGCGTAAGTTATTCGTTCAGCAAACGATCTTTTGGTTGGACACATCCCTATAAAGCGTTGTCGATGATTCGCTGGTAAATCA
TAGGCGCATTCTTCAATCCGAACGGCATTCGCAACCATTCAAAGTGTCCAAGTGCACAGACGAACGCTGAGATCTGCCGAGGTCGGCATGTCATCAAGAC
TGCCCAGAGTCCGCTCGCAGCATCAAGCGAGCAAAACCACAAGTAACTCTCCAATTTGGTGAGCAGGTCATCGACTAGTGGCATAGCGTATTCCATCGGC
GTCGTAATCGCATTAACTAGTTTATAGTCAATGCATAGCCGAATATTCACGCCATTTTTCTTGAGCACTATCACCACTGGCGAGGCCCAAGAGCTGCCCG
AGAATGATATCAACCCAGCTCGAAGCAGCCCCTTCAACAACTCGTACAGCTTGCTCAAGTGGCGGAGAGGTGTCCGCCGAGCTCTCTGTTTAATAGGTGC
GTGTCCTTGAACGTCGATGTCGCACAATGCTCCATACGCTGGAGGCGGCAGGGCATTACCATT