Description :
From Genome Similarity Track
Location :
Scaffold_182:16666- 20285
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19762hypothetical protein
Phypa_INRA-310PPTG_19763hypothetical protein
Phypa_INRA-310PPTG_19764hypothetical protein

Sequence
3619 bases(100 bases per row)
CTTCTCTGTGTTGAGTTGGTACGTTGCACGCATCTCTTCAAGCTGCTGCTCGAGCGTCTGGATGTTGGTCTCCAGCTTGATTTTGAGCTCGTTGTAGTCC
TCCGCATCTCGCACTCGCAAATCTTCGATCTCCTGTAAGTACTGCTCGTCTCGTGTTTGCTTGGCCTCCATATAGACCATCTCCATCTCTCGTCGACGCT
CGAATAGCGAGTCAATCTCAAGCTTGTTGTTTGCGATGAGTTCATCGCGCTCTTTCATAAAAGCATCTTCCATCTGCTCGAGCTCGAGTTCGTACTCGTC
CTGCATCTCTCGATACTGTTGACTCATGCGGTCGACCAGTTTTTCGACTTCTTCTGCCTGGATCTTAAGTGCCGTCACGTACTCTTCATCCTTGGCCTTC
AACTGGTTCTGGAACTCACGGATGACTGCATCTTTCGATGCCAAGATCTCTGCACACGCGCGATTCTGCAGCTCCAGCTCATTATGAAGCTCCTGTGGCA
TGCTGAACTCGAACAGATCTGCCCATCGCATCTCAACCGCAGCGTTCTTGGCGCCGCTGTCGATAGCTTCTTGCTGAAGCTTCTCGACGCGCTTATGACG
TCGCTCTTCTTCCTCGACGCGACGTCGATTCTCGGCGTCATCTGCTTCCACGCGGACGCTCGTGACATGGCGGATACCTGCCAATTTGCGACGGTCGAGC
TGGTTCAGACTGTCTGCCACCTGCTGTTGACCACGACTCATGCGCTGCGACTCGCCCACCTGAAGCTGCTTCTTGCGCGAGGCGTCATCTTTGGAAGCGT
TGCGTGCTTCAATGCGCTGTCGACGCACATTCACACGAGCCTCTCGGTCACTCGCCTCTGCCGACGGGTCTGCGTGCGCCTTGGAAGAGGACGCAGCCGT
CGACTCTATCGTCATTGTGCTCAAGAGCTCCAAACTGAGAGTGGCTTGTAGCCGTTATGAAAACGGCCCTTCAACATCATGTGGTTTACCTAATATATGT
ACCACACTAGAACGAGCAATAATTGGTATATTCTTTCCATCACATTTTCATACAAACTTTGCCCGCGCTGATGGAGCAACCTGCACCGACCAAGAATGGG
CAGCACATGCTGTCGCACTTGCTGGCCATCGCGTATCATGTGCTGGAGGAGACTAAGTACATGAACCTGAGGCCTCCGCTTCGTCCTAGCTCCAAGCTGT
TCGCACTCGACGCGCCTGCTCCGGGCTCACCCCCACGCTCCCCCACTGAGGCCGATACACCGCAAGATGAGACGCATCCGGACGTCAATGGGCTGGCCGC
GGGCTTCGCAGGTGCCGCGCACACGCAAACAGGCAATCAGGGTCACCCCATAGTGCTCCCGTACTCGCCCGAGGAGATCCAGGACACGTACACAAAAATT
GCGGCGCTCAAAGCTCAGTACATCAAGATCAGCGCCGAGTTGCTGGAAGCTGTCAAGGAGGTGGAGGCCAAGAAGACGCCGCCGCAGGACGATAAGGTGA
CAGAAACAGCATAACGCTTGGCGGTTTTCAGACTGACAATTGGTGATGTTGCTGCAGGACACGATGGCGAAGCTGGTGGCGAGGAGAAATCAGCTGCGCA
AGGTGAGGCGATCGCAGTAATTTACTTGAGGTGGTGCCGTGCAACTGGTAATATATTGTATGTTGCAGGAGGTGTACGAGAGGAATCTGGTGATGAAAGG
GCTTATCGACTGGCTGCGTAATCTGCAGCACTCGATCCGGCTCATGAAGGGAGGCACCGCGAACCCGCCCAATATCGTCATGGAGAGCGTCTAGATTGAT
CAGACTATAGTGACAGTCTTTTTTCTTCAATTTAATCAAAACGCTATTTATCAGCGTTATTTGTCAGCCATATACTGCAGGGTGTCGTCTGCCAGTGATT
TCGAGGAAGGTGAGTTCTCGCTGAAGCGATTGTTGCGAATCACTGAGCTCTTTGGCGTAGGCTACCAGCTGTGTGACAGCGTGCTGCAGGATACCGTTAT
CCTTTTCAAGTACTTCAGCGCGCGCTTGGGTCTCAGCCGCCGAAGTCTGGCACGAATCCAGACAAGTCTCCAACTCTTTGCATTGCCGAACCAAACTGTA
TAACAAACACAAAGATCAAGCATCAGGCACGTTGAGCGGTTCTAAACTAGACAACCATGCAGGTAAATGTCACCGTACTCTGTGCGTTGACAACGTTCGA
CCACCAGATCGCGTTTGAGGTTCCAGTTGGTAGAGATCGCCTGCTTCTTGCGCTTCTCACTACTACGGAAAGCGCTCACAATGGAATAAAACTGCACAAA
GGTTAACCCCACAAATTTGTCACTGTGAACAGGACTGCGAAGAGTATCACACCTGTTGTCGGGCAATAACTACGCTCGCTTGGAGCTCTCGGTTGCGCTT
TCCATACTCCCGCAACGCCCGTCCCAGTGAAACCTCACTGAAGTCACCGTTAGCTGTCGATTCAAAACCTCAAGTAGTTATCGTCACTGACCGATTCCGG
CTGGTCACCATTTGCTTGGTGACGCCCTCCAGCTCGTAGCAGAACCGCGTCAACGTGTCCTGAAGAAGTGCGAGCCGCTTCTTGGTTGGAATGAGCACTG
AAACAAGCTCACGTTCCGACAGCTCCAATGCTTGCGTGTGTCGTGTTAAGACTCGATATTCATCGAGAAGCTCGCAGTACTTTTCACCGCGTTGATGCAA
CAATTGATCTCTTTTCGTGACTTTAAGCTTGGACTGGAGCAAGTCTTCGACGAGCATCTGAGACGTCTCGAACTGTTGTTGGACTTGTTGATGAAGCTTT
TGGCATCTCGCTTGTTCATGCTCCAGGTCTTGTTGCAGCATGATATTACTTTTCAATAAATGTGCCGCATGCCTCTGATTCTCAGCGTGTTCTGCCGTAA
ATGCTCGTTCTGCCGCAAATTGCCGTTCCTTGAACTGCTGGATCTGTTGGTTTTGCTGATCGATCAGTCTAGTCTGTTGGTTAAGTTGTATACTTTGCTG
CTGAGCAGTGGCCTCAAGATCATTTACGCGCTGTTGCAGCATTTGAGTTCTTAAGTTATTCCACTCAGAGTCGCTCTTTCGCTCTTGTTGGATAAGACTG
TCCTGTAAAGCGGTCTTTTCGCTCTGTGCATCTGCCGCTAGATGACGCGTTTGATCAAGTTCTTGTTGCAGTTTCTCTCGTACGATGTCAGCAGCTTTCG
CAGCCTTGCTATGTATGCGAATGTCTTCACGCAGTGCTGCTTCACCTTCTCGTAATTTAATAAGCTCAGCACTTAGTAAGTCGCTCTTCATGAGAGCTTG
TGCCGCCTTCTCAACCGCTTCGTTAACGGCGACTTGAGACGCAGCGTGTTCACGTGCATGCTGTGCACAGAACGTGTCCATTTCTGATCTCAGCGTCGCC
ATAGCGTCTCTAAGCCGTGCAGCCTCCTTCTGGTCCTCACTACACTGAGCTCGAGCCTTCCGTAGTTTAGCGTCTTTCTTGGCCAACGCCGCTCGCATAC
GCTCCATCTTCTCGCAGATCTTGGCGTATCGCTCGCTGTCCATAGGCAGCTCTGAGCCGTTGTCTCGCATGGACAAGACCGAAAAAGCCAATGATGCTAC
GCTACTCGCGAGGCTGGCG