Description :
From Genome Similarity Track
Location :
contig_31:166608- 167787
Transcript NameFunction/comments
g6071.t1hypothetical protein

Sequence
1179 bases(100 bases per row)
TCAAAAGCCAGAAAGCAAGGAAGCATGTACCATACCCGAGTAGGACCAGCGACGTCGTCAGCTGCGAACTTCTCAGCCTACAACTTCAAAGTATTTTAAT
ATGAACCACCTCACCGATGCATCGAAAGCGCTAAGCCGAGTGCATTTACCAAGTTAATCCTGCTTGAACTGACCAAACTCTGCTCACTGTTCTGCACCCT
CGTCAACTTGATCCGGTGTACTTTCGTCTTCATCAGCCTCGTTCGTCTCGATCTCAACGTCGTCTCCGTCGGCATCAGGCGAAGCTTCAGCGTTGTTGGA
TGCTGGTTCATTCTCTTCAGGCGACGCGGCGGCCTCTTCCGGTCTCGTGGCTTCGGTGGCTGCAACATCGGCGTCATCTTTTTTATCATCGGTCGTGACG
ACTGTGATGAGTTCCGTCGCCGTGATCGCGCTCTCGACCTCGTGTCTGTGCTGGTTGTCCAGCATTGGCATGACTTTGCCCAAAGTTACTGGGTCGGGGG
TAAGCGCTCTTCGCGATCTCTTCACCAGCTTCCACGCGTCGGAGACGTGCTCCACAGCAAGGCGGTACTTCTCGTTCGCTTCAATAGCGTAAGACTTCAC
TGGGGCCTGCATAGTCTCCCAGGTAAGCTTCCGCTCCCCCGCCACTCGCTCCACGTCATTCTCGTGAATCGTATCCTCTGGCCACACGCACGTGAGTTCG
TGCGTGTTGTCGATCTTGTTCCTCTGGAAGCCCAGGCCTTCATCTGGTCTGTACCTTCGAGAGACCGACATGAGGAAGGGCTCCGCAAACTCTGGCAGCA
TCACCACTGGTAACTTTTCCTTTTCATGGAGGTTGTCGGTCTCCTTGGGTAGCGTCTCGCCGTCTTCCTTCGCGAGTAGTGACTGAACCAGCTCCACAGG
GAACAGCGCCGCTTGCTTCAAGAACGCCAGTATCTGGCCAAGTACGACGAGTACGAGACGGCCGAAGATCGTGTACAGCAGGAGGCCAAACGTGACTATG
AAGCACAGCACTGTCATCAGCATGACGTGAGAGTACACGATCTTGACCAAGAAACCGTACTGGCCCAGCACATCGTACTTCTGGAGCTTATCGGCCAGGA
TGCCGTAGAGCTGATCGGTTGTAGCGTTGGGGTTTTCCTTCAAGACGGACGAAAGCCCCACAGATCTCAGCAGCCATGG