Description :
From Genome Similarity Track
Location :
Scaffold_336:1666- 3333
Transcript NameFunction/comments
Phyke_g8502myosin-like protein

Sequence
1667 bases(100 bases per row)
AGGCACACGGGGAACAAGCCAACCAGTCCATCTTAGTGAGTGGAGAGAGTGGCGCCGGAAAGACAGAGAGCACCAAGTTTGTGATGAATTATCTGGGTAC
TATTGCTCAGCACAAGAATGCCGGtgcagacagcaacgtcatgAAGCAAGTGCTGTCTTCGAACCCAATTCTCGAGTCCTTCGGTAACGCGCGTACCATC
CGCAACGACAACAGTAGTCGTTTCGGTAAGTTTATCAAGATGGAGTTCTCGCCACAGGGAAACCTGATTGGTGCCTCGATCCAAACGTACCTGCTTGAAA
AGGTGCGCCTCGCGTACCAGGCCGAGTCTGAGCGCAACTACCACATTTTCTACGAAATCATTGCTGGTGCCACTgccgaggagaagaagcgctggaATTT
GAAGGCTCCGACAAAATTCCACTACTTGAATCAGAGCACTTGTGTGAAGCGTAAGGATGGTGTCAACGACGCAGAACAGTTCGGCGAGCTGAAGACCGCA
ATGCAGACGATGGGGTTTAGTGATGAAGATATGGAGAGCATCTTTGTGACGGTTTCGGCGCTTCTGCACATAGGTAACCTGGAGTTTGACGAAACCCACC
ACGCATCAGGAACTGAAGGGTCAGAGATTTCCAACGTGTGCGAGGAATCTATGAAGGTGGTGCTCGAATTTTTGGAGGTGGACAAGGCAGGCCTTGAACA
AGCCATTTGCAACCGCAACATTCAGACCAAGGACGAGCACTACTCTATTGGCTTGCTGCCAGAAGCTGCCGAGAACGCACGTGATACACTCGCTCGGTTC
ATGTACGGGAAGCTGTTCGACTGCCTCGTCAGCCGCATTAACGAGATTGTGGAAAACGAGGACCGTGACTGCTCATTCATCGGCCTGTTGGATATTTTCG
GTTTTGAAGACCTGGAACACAACTCATTTGAACAGTTGTGCATCAACTACGCTaacgagacgctgcagcaacactttAACCTTACTGTTCTGCGTATGGA
ACAGGAGACGTACGAAAAAGAGGAGATTCAATGGAGCTTCGTCAACTTCCCAGACAATGGGCCGTGCATCGACTTGATTCAAAGCAAGCCGTTTGGTATT
CTTCCTGCTTTAGATGAGGAATGCATTGTCCCTCAGGGTAACGACCAAAACTTCGCGCGAAAGTTGTACCGCCAGCACGAGCTGAACCCCCATTTCAGTG
CTAGCAAGACGGAGATGGCCAACCACCTATTTGTTGTTCACCACTATGCTGGCGCGGTCACGTACGACACATTCGGTTTCTGCGAAAAGAACAAGGACGT
TTTGTACCCGGAGATCACTACTATCCTTAAGCGGTCATCGAAGCCGTTTGTTCGTGGATTGTTGCAGGCGTCACCTGAAAAGAAGATGCCGGCCAAGAAA
CCAAAGGGCCGTATGTCTAGTGTGGCTACTCGTGTGAGTTTGGGCTCGCAGTTCCGTAACCAGCTGAAGGTGTTGTTGGAAACTATCAACGTAACTGACT
GCCACTACGTGCGATGTCTGAAACCTAACGACAAGGCAAAGGCAAACCTGCTAGAGTCTAAGCGCATCTGTGACCAATTGAAGGCTGGTGGTGTCCTGGA
AGCCGTGCGTGTCAATCGAGCAGGTTACCCTGTGCGCATGGCACACCAACAATTCATTAAGCGCTAC