Description :
From Genome Similarity Track
Location :
Scaffold_2857:1666- 3005
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2857-snap-gene-0.1Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family

Sequence
1339 bases(100 bases per row)
GTTCCATCATCGTATCGGGGTATATTGAGATCTGGGGTGCCGCGCACTTGACGCTCCACTACTTTCTCGGGATGCTCTCCGTCGTGATGATTGTCTCAGT
GGGTGCGGTCTGTCTAGTCGCAAAGGAAGACCCACTGTCAAGGGACGAAGCCGACCACGAGACGGTGCTCAAGCGCATTGGCGAAGCCTTCTACTCGATC
TACCAGGGGCTCAAGAACCTTCACGGTCAGCTCATCGTGTACAGTGTGGTCCTCTTCTGCTTGCAGTACGGGTACACATCCTACACCGGCAACAAGGGTC
AGTTCTTCGGTGTCGAAGTGTTTGGCGGCACGCCGAGTGGCGCCGACAACTGCGCGCCCGACTGCTCGGCCCAGCAAGACGCTTACAATCACGGCGTGCA
GGTCGCCGGCGGTGTGACGGACTTTCTGTTCAACACGGTCGGCTACCTGTACTCGTGGATGCTGCCGTTCTTTGTTCACAAAATCGGCGCCAAGTGGGTG
CTCACGCTCTCGCTCATGCCGCAGACGCTTTTCATTCTGATGGCATTCTCAAAGGTCGTGGAGCTCGACGTCGCCATCGTCGTGGGCACGGCGATGTCAC
AAACCTCAGTCTTCGCGCTCCTCGTGCCCGTTATCATCCACGTGCTGGGCGAGCAGGCCGACATCGGCATGTACGTGGGCGCGCTCAACTCGGCCAATTG
CTTTGGGCAGCTCATCAACTTTTTTGTGGGTGCGGCACTTGTCGAGACCTCGATGGGCTACAAGCTGCCGGTTCTCATTGGCGGCGCCGTGAGCTTGTTT
GGGGTCTTGATAGGTATCTTGTTCCTTCGACTGAGAATGTATTCCATGTAATACAGAATACCGTGCTTTCTCGGACGACTGTACTATCAGGACTCAAACG
ATTTCAGTGATACTAGCATTCCTTTGTCAGTCTAGTTAGCGCCTGTAGATGTACACGAGTTAGTGTGTTTAACGNNNNNNNNNNGCCGTGCTTTCTGGGA
CGACTGTGCTATCAGGACTCAAACGATTCTTAAAAGCCATCCTAATTAGCGCTTGTAGATGCACACGAGTTAGTGTGTTTAACGAGCACTGATGCTCGTG
GGTAGTCATCGCCCCGGTGTTCCTTGTCATTGGGAGTCGTCCAAAGAGTGTTATATCACGCTGCAGACTGCGTTTCAAGGAGCGACGATGTTTTTGGAGT
AAGGTACGTGTTGGAGGCGAAGCGTGGGGCCCAAGCCGAAGAAGAGCCGGCGACGCCATCCAGGAAGGCCGAGGGGCATACACCTCCACGCATCGAATTG
AGCTCATCAAAACGGGCTCAAAACGGGCTCAAACGGTAA