Description :
From Genome Similarity Track
Location :
contig_47:1666- 2711
Transcript NameFunction/comments
g7799.t1hypothetical protein

Sequence
1045 bases(100 bases per row)
ACGTGAACATGTTGCCCTTGTCGGTGATCATGTCTTCAAAGTGGTTGGCAACATCATCTTCCTACAAGAATCACATTTGTATTAGGGTTAACGGAGGCCT
GGATCCTATGAAACGTTACATATACATAAGCCTCGCTGGGTCGTGCGTGAAATCGTAGTGCGTTAGAGCTTCTTGACATGGCTGGTGGCTCAAGTGGTGG
CTATTCCTTCTTGAAAATGGCACCGATCAGCAGCAGTATCTCCTGCGTGCGGGCACGCGTGTCCTCCTTCTCTGTAGCGGGGCTATACATTCGGTTCACC
TCCTACCTTAGTGCAACATGCACTAATGGATACATTTAGGTTGGCCACTCCACAGGGTGGTCCACATTCATAGCCAAAAGCATATGACTGGTAGAAAGTA
ACATCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTAGGAGGAAACCCC
ATTTACAATCAATACAGTTCTCATTTAGCACCAAAACTATCGTTCGGTCCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAG
TTAAATACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTGAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGT
CCAACGACCGACTAACACGTTCGTATGGAATACAAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAA
CGCATGTTGCGCGTACAGACCGCCCCCACCTGTCGGAACCACCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACG
CTATCGCCGACGGAGCAACACGATGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGC
GCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAG