Description :
From Genome Similarity Track
Location :
scaffold_5:166597- 177568
Transcript NameFunction/comments
g8127.t1hypothetical protein
g8128.t1hypothetical protein
g8129.t1 conserved hypothetical protein
g8130.t1 conserved hypothetical protein
g8131.t1hypothetical protein

Sequence
10971 bases(100 bases per row)
CGACCACACGTGCAAATGGACTCGACGCTCGACCAGCTGCAGCGCACAAGCTCTTTTGCCTCCAGGTGGCTCTGTCGGTCTTCTGTTGCGACTGGCAATC
GGGTGTTCAGCACTTCGCAACCGCCGTCCCACACGCGCCTTTCGGCCATCAGTTCGCCTTCTCATCTGGTTCGCCTGTAGCCATGAGAAAGTCTATGTCG
CTGCCGATCGCGCCGCCTGTCAAGCTGCGCCGCCGCAAGTCGTTGCGGGAGGAGCAAATGAGTCGTTCATTCTCGTTCACCAAGCGCCGCGTCGAGCGGC
AGCCGTCGCGCCTCACACCGATGAAGTCCATGGAGCAGACGCTGCTGGACAACGTGCACGTGGAGTTCGTCAAGGCCGTGGTGCCCGGCCAGAACAAGCT
GGCCAGCCCGCGCTACGTCATGCGCATCAACAACACCGCGCTGGACCAGACGTGGGAGATGGCGAGGACATTCAAGGAGTTCTACGAGCTCAAGGAGGCG
ATCGTCCGCGTACTCGACTACGGCCACTTCTGTCCTTCAAACTGCCCGTGGCTCTACATGTACGCGGCGCACCACTTCCCGAGGCGCCACATCTTCCGTT
CGCGTAGCCCTTCCGTGATCGCCGGGCGACTCACCGAGCTGCAAACGTATTTTTCGACGCTGCTGCGCATGGCCAAGCAGAACCGCAACCTCGAGTGCGC
AGTGTCATCTACCAAGCTGCCGCAGCTCATCTACGATTTCCTGTTCGAGGGCATGGTTTTCGACCGCTCCGACTTCATGCGGTTGAGCGAGCGTCTCTCG
ATAAATACCCGCGACAGCAGCTTCCTCGACAACGACCCGACACAAGATCCGGAGGAATGCTTCATCTGTCGCAAGGCTCTGGTGGGCGACTCCAGCGTAT
CGATCGTCCCAGCAGCTCCAAGCAGTAACAGGGGGCCTTCGAGCAAGAAACGCGATAAGCACGTGATGGCGGGCCTCACGACTCTCGACTGCGGCCATTG
CTTCCACGACGAGTGCATTCTCGCGAAACTAAACGAGTCGCTGACTTGTCCACTGTGTATAGCGCAAACCAGTCCTCCACAGTCCGGCGTCGCTGCTGCC
TAGTTAACGAACAACCCGTGCACTAGAGACCTCTTAACCTAGCTAGAAGGCTGTGTGTACTTGTTCATAAATGACATGGGAGCCATATTCAAGCGCATCA
AACCCCATTGCACCGTGGAGATTCATATCACCTCCAAACGATTAAAGTGCAGCAATACCCGCAGCGTGGCTCTTCTCGTCGTTTCGTCTACATGAAGCCC
ACAACGAGACGGCAGTGACTATCTCTTCACGCTCAGGAGAAAGGCTCGGCGGTGTCGTGTTCTGTAGTACTTGTCTGTCTGTGTAAAACCCATTTTATAT
ATCCAAAAAACGAATAACCCAATACCAAAATAACCCATTTATAGTAACTTGGGCATGAAGCGTGGGAACGTCCGCAACCAGGAGGTGCGTATCCCTCTCT
GTCTCCCCCTCCTCGCTGTACCGACGGGCTTTTTCTCGGATGCGATAGGTAGTCAAACTCATCGTCTATCACTTCCACCGCTTTTCCGCAGGTTACGGAC
GAGCAAGGCCGCCGGCGTTTCCACGGAGCCTTCACGGGCGGCTTCTCTGCTGGATACTACAACTCCGTGGGTAGTGCGGAAGGATGGACGCCACAGACGT
TCTCGTCTTCTCGGAGCAATCGCTCGTCCCAGATCCAGCAGCGGGCTGAGGATTTTATGGACGAGGACGACGACCCGCTGCTGGGCAAACGACTGGAGAC
CACGGAACGCTATGACACGCTGCAAAAGGGAGCCAAACGACAACTGCAACAGCAGCAACAAGTTGGCAAAGCTGGAGCTGCAGCTATCCCAGGGTTCGCC
TTGCCGGATGACTGGGTTCTGCCGGTGAACGACTCCGTTGGAGCTAAGTTGTTGAAGCACATGGGGTGGAAAGAAGGTCACGGCATCGGGCAGCGAGTAC
GCAGACGCAAGTACGAGGAAATGGAGAAGGAGGGAGTGGAGGGACCGAAACTATTGATGCAAAGTGCTCATGAAGAGAAAACAGAGTCAGAGCCGCAGGA
TGAAGAAGAGGTGTACGTTCCGCCACGGAAAGTGTTTGACATTCAAAAGGCTTTTCCCAAGCCCAAGCTGGATCGGTATGGCGCGGGATTTGACCCGTAT
ACGAACGCTCCCGAGTTTGCGTTCCACAAGCAGCAAAAGGAGGAGAATCAGAGAATGAAGGAGGGGTCTCACCGTCAGGTGGTATCCTTTTCAGACGCTT
TGAAAGCTTCAAATGGCAGCAATCGCGCATCGGGAGGATATGGACTGAGCGCGCTGGAAGAAGACGACGACGTCGATGTTTATGGAACTGTCTCAATGAC
AGAATTTGATCGGGTAATTGCCCCACTTGGAGCGAAGAATGACATTAAGCGGCTGGATTCATCAGCACTACCCGCGCGTCGGTATGAGAAGGCAAGACTC
AGTCGAGCTTTGTGCTCAGATGGACGACCTGTCCTTCCTGGGTTTGAGTTAGCAACGTCGAAGGAAAAGCCTCCGAAGGTAGTTAAATTGCGTCTCACTG
TGCCGTCGGATTTCAAGGCCTTTCATCGCTTTGATGAGGAAGGAGGGCGCGATGATGCCGTAACAGCGTTGTATCGCAAGCATAATTTCTCCTCGGGTAG
CGGTGGAATGGTTGTAACAGCGAACCAACGTGGCGTTCTCCTGGAAGACCAAGGGGGAAATGGACGTAGCAATGCTGGCGCGGGAGTTGGTAGCGAGGTG
AAGGGCCCAGCTGCGAGTGTGTTTGACTTGCTTGGCGAGGAGCAGAGGGCGAAACTGTTCGATGCTGCTGCTCAAGCGAAACAGGGGCTACCTTCGTCCA
GAGTTGCACATACTACTTCAGTCAAAGAGTTAGCCGCTCCGAAAGTTCGGCAACCACTTGTGCGTGGTGGTAGTGGTGACGACCAGTTTCGAGCAACGAT
TTCAGCGTCGATTGCGAAACGATTCGTTTCGTCAAAAGGTGCAAGCGACGAGGAAAAGAGCAAGCCTGATCCTACTCAAGAGGTTCACACGAAGGCGTCA
CGCCGGTCGCAGAGTTTGTGGATCCCCGAATCACTTCTTTGCAAACGTTTCCACGTAAAATGTGCCGGACCGACTGGCTCTGGGGTGAAAGATGACGATA
GCGACAAGAAGCGTGACCTCTTCGACAAGGAGCTCGTTCCCCATTTAGTAGAATTTGCCGCTGACCGAGCTGCTCATCAGCGTCCGCCAGAGAAGGCACG
TGAAGCTTCGAAATCGGGCAAGGTTGCTGAAGATGAACGCGTGCTGCCACCTTTACCTGCAGTAAAACGAACCTCGGCCAGTCTGCTCAAATCGATTTTC
GAGCCGTCGGATGAGTCTGAATTGAGTGACTACGATAGCGAGGATGAAGAAGGCGATGACGGCAATGTAGAAGAGATGGAGAAGCAAGATTCTGCCTCGA
GCTTTCCCATCGGGAGTGCTGAACAACTAGTGCGAAATCATCAGCACGACCAACGTGACGTGAGCTCAGAGTCAAGCTCGTCAGAAGATGAGGTTGGTGC
TCACTCCTCGATGCTTGGCGCTAAAGTTGGCAATAAAGAAGATGACCGAGGCATCAAGCGACTGCGCAGTGAAGATGACACCGACAATGGAGATGCGAGA
CAAAAAAAGAAGGACGAGAAGCGGAAGCACAAAAAACACAAGAAACACCACAAGCATCGCTCGTCGCGTGACGACAAGGACAAGAAGAGGAAAAAGGACA
AAAAGGATCGAAAGTCGCACAAGCACCGCTCCTCGAGACACTCCAGGCGAAGCAGAAGTCGAAGTGGGGAACGAAGCTCGGGTCACCGTCGTAGCTCCAG
CAAACAGCACTAGCAGTAAAGCTGGAACTTCAGTTCTCTACTAACAAGAGTACTTCAGTAATGGAAGGAGTAAACCGACGCTGTTGACACGGCGGCATGG
CGATTATTTCGCGTGGACTAGCCCAAGCACTTCAACTTGAACACAAAAAACGAACAAAACATTTTTGAGTCTCTATGTAAACAGAATCGATTGAAGCTCA
AAGCAATGCAAAAACTAATCAATACACGACAGAGGGCTGGCCCCTCTACCGAGTCAAGCACCGTTGCCTGGCGCTTAAAGCGCATGTGTCTCCCTGTGTT
CGTAATCCTGGCCTATTTGAAAGCTATCCCGCTCACAGCAGCCGCCATTAAATTAGTCGAAGGTCTTCTTGTTGCCCTGGAAGTTCTGGATGGACGACGG
CTGGCGTCTGGGGGGACCATCACCACGGCCACCACGGCCACCGCCGCGACCACCGAAGCCACGGCCACCGCCACGGCCTCCGAAGCCACGGCCACCACCA
CGGCCTCCAAAGCCACGACCACCGCCACGGCCACCATCAAATCCGCCGCGGCCTCCACGGCCTCCACCACGGCCGCCAAAACCACCACGGCCACCGCCGC
TGTGCTGCTCGCGGCTCTTGGCGTAGTTGACGCGAATGGCACGGCCGCTCACGTACGAGCCAGCAAGCTTCACAGCCTCGTCGACGGCCTCAGTCGTCTC
AAAGTCAACGTGGCCAAAGCCACGGAACTCGCCAGTCTCACGGTCCGTGGCCAAACGGCAGCTGAGGATTTCACCACACTCGCCGAAGGTTTCACGGATG
GTGTTCTCATCCACGTCCCAAGACAGGTTGCCAATGAAGACGCTCGTGCAGCCCTCCGGCTTCTCGTCGAACATGTTCTTCTTCTCGGCCGTGCGGATTT
TCATCCAGCGGCCTCCAAAGTCTTGGCCGTCCATGGCAAGAGCAGCCTCAGCAGCCTCCGGAGTAGCGAAAGTCACGAAAGCAGTACCCGACGAGCGGCC
GTTCTGCAGAGGGATGCGAGCGCCAGTCACCTCACCGCATCCGGCAAAGTGCTCCGTCACCTCCTCCTCCGTGGCGGACCACGGCAGACCGGCAATGAAG
ACCTCAAGGTTCTTCTGCGGGTTGGCAACAGCAGCGGCCTCGCCGTCCTCCTGCTTGTGGACCTTGTTGGACTTCTCACTAGCGTCCGAGTTCTTACGCT
TCTTGGACACAATAGGGGTCTCCTCCTCGTCCGAGGACGAGTCCGAGTCGCTGGACGACGAAGAAGACTCCTCCTTCTTGGCAGCAGTCTTCTTGGCAGC
CGGCTTCTCAGCCTCGTCATCCGATGAGTCCGAGGACGAGCTGTCGCTGTCCTCCTTCTTAGCGGCAACCTTCTTGGCAGGGGCAGCCTTCTTGGGAGCC
TCCTCCTCATCAGACGAAGAGTCCGAGCTCGAGTCCGAGCTCTCCTTCTTAGCGGCAACCTTCTTGGCCGGGGCGGCCTTCTTGGGGGCCTCCTCCTCAT
CAGAAGAAGAGTCCGAGCTTGAGTCCGAGCTCTCCTTCTTGGCCACCACCTTCTTGGCAGCAGTCTTCTTAGACACCACCTTCTTGGGGGCCTCCTCCTC
GTCGGAGCTCGAGTCGGACGACGAGCTGTCCGAAGCCACGGGCTTCTTGGTAGCGACCTTCTTGGCCACCACCACCTTCTTCTGCGGGGCCTCGTCGCTG
CTCGAGTCAGACGACGAGCTGTCGCTGCTGGACGCAGGCTTCACGGCAACGGGCGTTTTCACCTTCTTGGCCATCGTGTGTAGAGCAATTGGAGAGTCGG
GAGCTGTCGGGGCGTCGAGCGATTGGCAAATGACCAGCGAAACACTCGCACAACAGGCCGTTGGCTGGGATACCTTCAAGCGTCAGCACCGGTTTGGTTG
GCTGCCGCGCTGCATGGTACACTGTGCCGCGTTTCATGTGAGCCACACGAAGTGTGTGGTGCACATGAAGCCAGTTCGTGAGGTTTTTTTCCCTTTCTCC
CCGAGGCTTTATGTGTGGCGGGTGTGGCCCCCCACACAACGACCACACAGTCTTTCTTTCGAAATCCGGCGCGCGAATAAATCCTAATAATGGTGGCAAG
TGGCGACGAGAACGTGGCGGTGGACGTGGCGGTGGACGTGGCGGTGGAGGACGCGACCAAGGTCGAGCACGAGCCGGTGGTGGGTGAGAAGCGCCACGAG
CGCTCCGAGGACATGGACCCGCTCGTCCCGGACGTCGACGTCGACGTCGACGCCGCAGCCTCACAGGACTCGCAAGCGACGCAGGACGACGACATCCAAG
ACGTTGTGGCTAATATCAAAGAGGCCACGGCCGTCGACGTGACGTTCGACGCCGCCGCCGCGGCTGCAGCCGTGGTGCCGCCCCCCGAGGTCATGAAGAC
TGACTCGTCCACGCCCGTGCAAGACGCAGTCGCGGCGGCCGCGGCGGCTGGCGTCGGCGTGGACCCGAACGGTGCCGCCAACGTCAAGTTCGACAGCAAG
CGCATGGCGCGCGTGTCGTTCAACTCGTGGTTCGACTTCGACGCGTACTTTGAACTGTACATGCAGGAGACGTTCCAGCCGTTCCGCATGCGCTCGTCCT
GCAGCGTCGAGGCATACCGCCGCAACCAGCAGAAGGTCATGCTCAACAACAAGAGCTCACGCGGACGCCGCGCCGAGTTCCCGGACGAGGCCATCCACCA
CCACCGGATATACATGTGCACGCACGCCATGAAGGCGCGCTGCCGCGGCGCCAACACGCGTCCTGGGCAAAAATACCGCGGTATCGGCTGCATGGCCAAG
ATCAACGTCAAGATCACCCCGGCGGACAACCCGTCCAAGTACATGGTGATCGTGACGGACCAGGTACGAACGGCACCCGATTTGCTTGGTTATTTATTGT
GATTTGAGATTGACCCGTTGTCTTTTGCTATTGGTGCTGCAGGTTGTGTCGCACAACCACCCGGTGAGCCGCGAGATTTATGAGGCATATCCGGATGTGC
TGCTCAAGATGATGCGGCGCAGCCAGCTGTCCCAGTCGATGCTGGGTCACCCGCCCCCGCCCAAGTTTGAGACGCCTCAGCAGACGCAGAAGTACGAGCG
CGCGATGAATACGTTCCAGTCGATCGCCGAGACCATGGCTCGGCTGGCTGACGAGGACTACGAGCAGCAGCTCGGGCAGCTGCAGCGGCTCTACACCCCC
GCCACGGAGCAGGATCAAACGGTCTGAGTATGAAGTCGCGAGAGAGGCGAACGGTGGCTATATACCAATACGCGATGAGAAGAGGCTGCCAGCGAGATTC
GATTTTTGCTCTTGCTGTGTAGCAACGTTCATGTCCAGCATTCATGTGCACGCTAATGCATCGTTGTCACTTCACTGTGGCTCATGGGTACACAAGTTTT
ACTACATCCACAAAATTTGATTACCTTTTTGTGTATGCAATGTGTATCATTTGTGTTTGGTTTGTGTACCGAGGGGGAACTGAGAACAATACACGACATC
TGCATCGCAGCCTCGTAACCGAAGCAGCGATGGCGAGCAGCGGCGTGGACGTGGCGCTCGCGCCCAACTCGAGCGTGATTCTAGAGCCGGCGGACTCGCT
GTCCTTCCATCTGCAGCCGCAGACGGCGCCCCAGGCGGTATTGACGATCCGCAACGTGGCGGACGACCGGCAGATCGCCTTCAAGGTCAAGACGACGCGG
CCGCTGCGGTACCTGGTGCGGCCCAACCAGGGACTGCTGGGGCCCAACGGCTCGGCCTCCGTCATGGTGATCCTGCAGCAGAAAGACTGTGACGAGCTGC
TGCGACTGGACCCGGCCGAACGCCAACTGGCCAACGACAAGTTCCTCGTGCAGAGCATCTACGTGGACGACAGCTTCTACGAGCTGGTCAAGACCAAGTC
CACCAAGGAGATGGCGGACGAGCTCACCAACATGTGGGCGCGCACGGACAAGCGCGCGCTGTCCAACAAGAAATTGCGCTGCCGCTTCGTGCAGGACAGC
GAAGAGTTGGGCCGTCCGCCGTCGCCGCCGAGTCCACAGCGAGCGCCGTCGGCCAGCGCCTCGCCGGCCAAGACAGCGACCACGTCGGACATGAGATACC
AGAGTAGACAGAGCGACGAGGTCGGGGACGAGGTGGCCACGCCCGCGCAACTGTCGTCGGCATTGCTGCAGGACGACAAGCCGCAGGCGCCGAAAGTGGC
GGAGAACAGGGAAGGAGGCAAGGAAGCGATCCAAGAAGTTGCGGCACTTCGGAAGAAATACGACGAGGTAGGTGCAGGGTTGAGGTACTGTGGTGACGAG
TGGGGCTAATGGAGGTGCGTTGTGTGCTTGATGGTGCTCAGTTGGTGGCGTTCACAGTGCAGCTTACGGCTCAGCGCGACGTGTTGATGAGCGATCTGGA
CAAGACGCGGCAGCTGCTGCAGAAGGCGAGCACGGATGCACAGCGCGTGAAGAAGCTTTCAGAGGAGTCATCGACTCTGCGTCATCGGAAGAACAACGGA
AACGGAGCTTCTGGTACGGAGGACTCGCAGGCGATTACGGGAAAGGGTCCCAAGGAACAAGGGGTACGTCTTGGCTCATGTTGATACGATAGGCTATGCT
GGCAACTGACAGGTTTTGCTGTGACAGGCTTTTGGACCCTTGCACCTGCTGGTGTGCGCGATCATTTTCTTTTTAGTTGGGCGCTACTACTAGGCAACTT
GCGTGCTACGTACGTACGCTGGAGTTAGGCAGAGACAGAAGGTGTTGCTGATGAACGAGGGAGGCAACAGCACGCTTGAAAAAAAAGGAAATTGAAGCAA
TAGAGCTTTCTGTCGAGCTGCGTGAAGACGCTGACTCGTGTTCACATGTGTGGAAGTAGGCCGGTAGTGCAACAATCTTGGTTACTTGAAGTAGACGAGA
ATCATATAGTAGGAAGAGTACTACGTAGTAAGTAGACCGATTCCGGACAGGAACCCTTCGGGCCTCTTGGTTCATGGTCAAACTGTCAAAAGTATTCGTG
GAAACGAGACTTGCAGTGAACTTGATGGTGCATTTGATAGCGGCAGATGGACTACAAGTTACTCGTACAACGCCCTCTTCTTGAATGTCTAGATCTGACG
GATTGACATCGGCAGTGTTGCTGCTATAAAGTCGGGTTGTGCTGATGTGTGGCTAGTTGAGAATTGCTGTGACGCTCATTTTGCGCTTGCCTTCCATGTC
TAGCGGCGCGCAGGCCTTGCGCTTAGCATTCCGAGTGCGGCAACTTTCCGCGGCACTGTCACCGCCGTCGCTGCTGATTCCAGACGCGTGCAAACCAGCG
CTGTCTTTCATAGAAAGCATCGCAATTGCAGCTGCATCGCTGTCCGATTGGGTACCGGCAGGGGCAACACGCACTAGCACTGGAGGCAGGATGGGCTTTT
CTTCCTGGGGACGACCGGCAAAGCGCAGTGGCGGCACCTCAGCATCATCGTCAGGGAAATTTGAGTCATCCGGATTGTCCTCGTACTCTCCATCGCCGTC
ATACGCGCTCTCAATCTTCCGAAGTTGTCGTACATCGTCGCGAAGGGCGTTTACTCGTACGAGTGTGACTGAATCTTCTGACCGTGGTGAAGCTTCATCC
ACTGAGCTTCTATACCTGCGTCCGTCATGGCGGCTGCCACTTGCGCCGGGTGGAGTGTGACTTGGCGAATGGCTTGATGAGTTATTGTTACCAGAAGACG
TGTCATCACCGACATCACCGCCGCCTGAGGTGGGGCCTGAGCTGCCGGGTGCCTCCCCCGAAGGTGAGGAGGACGAACTACCGCCACCACCACTGCGTCG
AGAGGACGACTTTTGCGCATCGTGCTGTTCGATACTTGAACCCGTTGCCTGCATGAAAATGTGCTCAAGGCGGTCGATCATTTGCAGCAGCGGCTCATAC
GTTGCGAAGGGCTGCTTCATCAGGATCGTGTGCATGAATTTGTTGCGTGTAGCATATCCCGTCCACTTGTCGTGCTTTTTCAAGATCTGAATGGCACAAC
GCAGTAGGCAACCAGACGTGAGTCAAGTTGCTTCAACAACGTCAGGCAGACGGAAACGCTGCCAGGGGGACGAACCGCCTGACTCGACGCAGCGGTCAAT
ATAGTTAGGATCCGACCTTGGAAATGCCGCAGAAGTTCATCACGGCGAAGTTTTCCAGCAGCAGCAGCTCCTTGTACAGCGCCACGCAGTTTTTCATCAG
CGCTGTTTTGGCTTCCTCGGATTCTGGGTTCGTCTGGACGACATACCGCGAAATTGACAGTTAGACCTCCACGCTAATGTTTATCAAAAAAGAATTCCAG
CCCCATCAACAGCATTTCTCTTTTCAAATACCTTGAGCTGCTGGAAACTGGCGTCAATGGCTGCCACCTGACTCGTGTGTTTGGCCTGCTCCTTGATGAA
GAAATCGGCAATCTTCTTGATCTCCACACGCAGCGTCCGGAAGAAGTTCATTTCATCCTGCGACTGGCCTGCTCCAGCAATCAGAACCAATAAGAACCTG
TCCATCAAAACGACCTCCGCGCGGCACTCACGGATGCTGTCGTTGTCCTCCTTGGCGGACGGTTTGATCTTGATTTTCACGAGCTTGTCGCCCTGCAGCT
TCTCCTCCTTCTTGATCTGCGCGCAGTCCTTGATGATCTTCTTGAGCAGCTTATAGTCGGCCCAAAAGGGCTCCCAGGCCGACGGCGACATCTGCGTCGA
CTGCTGCAACACTTTGCCGAACTTCATTTCGACCTCTTCACTCCTAAAACGCAATCGCGGTCTGAGCAGACAAAGCAACTGATAACCAGTCAGCGGGCAG
ATTTTGCTCTTCTGCAGAGCGCGGCGGAGCTGGCAACTGGCGGCGAGATTCGATGCAGAAACGAGGAGAAACCACCTGGTCGAATCTTTTCCGTCGCCCG
CAGCAGGAGGAAGAGCCCGAATCTCCAACGCGGACATTGCGCTCTCCCTCCGTCGCTTCGCCACTTCTCACGCAAGCACATCGTGCAGACTTACCTGTGG
GCGCTAGTCGCAAAAGCTGCTATGTATGGCTACGCGGAGCCGATCGGTTATTGTCTTGTGTGCTGCAAAGC