Description :
From Genome Similarity Track
Location :
Scaffold_43:166544- 168462
Sequence
1918 bases(100 bases per row)
CTTTGCCGCATTCCAGTCCGACGTTTGTGTGAAGAAAGCCACGGGTGGTTGGCGCATCGTTCATGACTTCACCAAGCTAAACGACGCAACCATCCCGGCC
CAGACTGCAATTCCTCGGAAGGACATGGTACTCGACACCATGGCTCTGTACACGTCGGATAGCGAAGTGTACAGAGCCATCGACTTGACCGATGGATTCT
ATCAAATCCTCATGAGGCAGAGCGACATTCCTCTCACGGCGGTGAGGGCCCGCAGCGGTATGCTCTGGGAGTGGCTTGTCATGGCACAAGGATTGAAGAA
TGCCCCAGCCAGGTTCAATCGCATGGTATCCCGTGTGCTGTGCCCACTCCGTGACTTCGCGCCAAGCTACTTCGACGATATAGTCGCGATGATGGTATCT
CAGCGTGCTTGAGGTCCACTTGAAGCATCTAAGGCAAATCGTCCAAGTGATGCGTGAAAACAAGCTGTACGCGAATATGAAGAACTGCATCTTGGAGATT
CCGGTGCTTGCTTCTTTTGTGAGCAAGAACGGCGTCCGAGCTGATCCCGAGAAAGTGTCGCCGATCTGCGCATGACCCACGCCACAGAGCCCCACTGAGT
TGCGTCAGTGGCTGGGTCTGGCGAATTACTTTCACAAGTACACGAAGAACTACGCCAATCTGATTCAGCCGCTCCCCTCGCTGTTGAAGAAAGACGCGGC
ATGGTCGTGGACTCAAGCGCATCAAGACGCCTTCAACTCGGTGAAGAAAATCCTGGCAGAGGCTCCAATTCTTGCTCTCCCGGATGACTCGACACCTTTT
CACGTCGTGTGCGTCGCGAGTGACTTCGCCATCGGCGGCGCGCTGATGCAATTCGACGATGAAGGTCGCGAACGAGTCGTGAGTTACCAGTCCAGGCAGA
TGAAGCCGGCCGAGAGGAACTACCCGGTCCATGACAAGGAAGTTCTCGCGGTGAGATATGCTCTGATCAAATTCAGGGTGTATTTACTGGGTTAAAATAC
CTTCGCGGTGTATACCGATCACGCATCGCTGAGGACAGCGATGAAGAGCCCGCATCGGTCCCCACGGATGGCCCGCTGGCTCTCGGTCTTCTCTGAGTAC
AACTTCGTTGTCCACAACAAGCCCGGCAAGAACAACATTCTCGCCGACGCTTTGTCTCGGCGACCAGACTACGACCCACGAGGTTCATTGGGACGACAAG
GCTTGCTCGATGAAGACGATGTTGATGAATGCGCCATATGTCAAACGTCGGGATTGAACCTGACGAGCGTCTCCCCGGAATTACCGCTTCGCGACGAAAC
CCGAACTGTGTACGGCCACGATCCGACGTACGCCAGTATCCTGAGCATCTCCGCTCTCCCAGCGACGACGCGCGGAGAGCTCTCTCGCGACCCATACGGA
ACCGCATCGATCGATATCGTCTTGAGGACAATCTACTGACGTATACCATCGACAACTTCGATGCTCCTCGTATTGTAATTCCCAACGACTCCAACCTGTG
CTCACGGATCATCCATGAGTTTCAGGATGCCCCGCTCGGCGGTCACTTGGGCCGCGAGAAAACGTTCGGAGCCGTGTCACGCGATTTTTATTGCCCCCAC
CTCTATAAATGGATACGCGAGTGGGTGCGCACGTGTGATATCTGCCAACGCGTGAAGCCATCTTCGTCGACGCAGGTTCCCCTGCGTCCTCTTCCAGTGG
CCACCGAGGCCTGGCGCTCGGTGTCAATGCACTTCATCTTTGGTCTTCCACCTGATGCTCAGGGTTACTCAGGTGTCTTGGTGTTCGTGGATCGCTTCAG
CAAGATGGTCCATCTCATTCCAGTATCGGACAAGATCTCCACGGCCGACACCGCGGTGCATTTCATTGACACCGTCTTTCGTCACCATTTTCTTCCCGTA
TCCATCGTCTCTGACCGC