Description :
From Genome Similarity Track
Location :
Scaffold_594:16654- 20879
Transcript NameFunction/comments
g11195.t1hypothetical protein

Sequence
4225 bases(100 bases per row)
AACTTATCCGTTCCAGATTATAGCCATGGATCACATACCCTCGCTGCGGAAATCGCATAGAAGCAATACGGAGTTGCTGATCTGGGTCGATCTATTCACC
GGCTATGTGATGGCTAAGGCCAGCTCATCCAGGACGGTGCAAACGACAGCAGAGTCCTACGAATAATGTGTATTTCGCCGATTTGGCGCGAGTGAGGTGA
TTCGGCATGATCGGGAGCCAGGATTTATGTCCGACGTCTTCCGAGCGTTCAACAAGATCCTAGGACAGCGTCAGTGGGCCACTATGGCTTACCGGCCGCA
AGCGAACAGGACGGCGGAGTGCATGGTTCAGACGATCACGCGCGCACTCTAGATGCATGTCCAGGATCTGGATCAACAAGATTGGGACGAGTACGCAGAG
CGGCTTACGTTTGCCCTTAACACAGCCCAAGATGGGCTCCGAGGTGATACGCCTTTCTATTTGGTACATGGTTGGGATCCTAGATTTACATTAGAGGCCA
CGATCCCGATGGGCAGTACTCGACGTCAAGATCGCGATCCACGCCGATGGCGCTACCGGACCCAGCGTTATTATACGCGGGTCCTAGAACGGGTCAACGA
AAAACTCCGTGAGGCGATTGCAGATCGAGCAGATTAGCACAATGACGACGTCCGGCCCCACCAAATAGCCTGGAAACACGCTGAGATAACGCCGGACAAG
CCGCCGTGATTTCCGGGGACCCGGGTTTACCCAGCCTGCGTTTGGACGCGTCGTGATCGCGAAGACCGCCATGGAACTCTCCGAAAGGCTCAAGACCAAA
TTAGGTGACGCGCATTCGTACGTGATCTGTCCTATTTCATATTTCAGTTGGGAGTGTGTCCTCTAGACCCCCCATTTCATAGTAATTGCCGTTTCAGGAG
GTTGTTAGTAGTCACCCCCCGGAATTTGATCGAATAGACTGCTGTGTGATAAGGACTGTATATTGAGTGATCCGGAAGTGGTTTTTCCTTTTGGATATAT
TTGAAAGTTATCTTCTGGAAGGAGTTATAAATCCTCCTTCTGGGAGTGGTGCGCAACAAGGGTGCATCTGGAAGGGACCAGTCTTCCAGGTGAAACACAA
AGTAGACTGGTGTACGGACCCACTGCTCAAGGGTCCAAAAGAATAAGTAGCAGCTGTATATTGTGTATAACTCTCTGTATTATTTGATCATCTGGGAAGG
CTTTGCTAGTCAGCTGTACTAATTGCGTCGGGAAGTGAACGTACGCACTCTGTATTCTTGTATTCATTTTGATTGTGTAGGAACAACTCACCAGGTGGAG
TCCGGTCTTCCGAAGACAAACGACACCTATAGGGATTACACAAGGTCACACGCCAAGCTACTTCCGGAGGTCCCGTACTTTTGGAGGTAGTCTGACCCCA
TAGGGCTTTCCGAAAGGCGAAGTTTAAGCTTCCTGATTGGCCGAGTCTTCTGGTGCGCGTGCGCTATACACCCTGGACGATAAAGGCGTTCACCCGCCTC
GCCTCAGATCACCGAGCAGAACGTGGGGATCTGTTGGCCACTCGTCTCTGGGAGGCCTTGGATAACTCCGACCAGGCTATCACCTTCGATCCAGCTGCTG
CCGGCCGCTTGGGACAGTTCGCCCGAGAGTATCTAGTCCACGAGACTCATGATCTGCAGACTTACTGGGAGAGCACGCACTCTTTCCCGATCTCGAAGGC
TAAGTGCTAAGCCAACCCCTCGTAGGCTCGCCATCGCAAGAGTCGTAGTAATCGGCGCGGTCACGCGGGAACTCGCTGGAAGCACGTACTCTGGCTCCTG
ATCTTGGTTATGCGGGACAGCTGGTGTGATCTAGATGTTCTACTGGACATTTACTTCCTTCACTTCTCCACCAGATCGGAGAAGGTCACATGGTACCCTG
GGGTCGTTTCACGCCTCACGAAGCTGGCTTATCCTCTGGTATCACAGGACGAGCCGACAACACTTCTGGAGGCACTCGATGAGTGCAACCAGATCCCTGG
CGCAACCATTTCCGTGATTCCCCTCAAGACCACCCGGCGTACCGGGAGATCCAGACGGATCTCCTGATCCTCCAGCACCTTGGCGGGGCGAGGGCCGGCG
AGGGGGTGTCGCGTGTTTATGGCGGCGATCTTCGGATCGGGACTGAGCCAGAGTGCGCAAGGTGTCATGATTGAAAGCCTCTTCAGCGTCCTCAGCTTCA
GCGGAGTCTTCCTCGTCATCACTCTCTTCAGCATCACCCGGCATTTCGGACGAAGAGAATCGAGAACGACGCCGGCCGGATCCGTTGCTATGCTCCGATC
CGACCTCAGGAGGATGTTAGGGGTCTCCAGTACCGTGGTCCGATGATGCGTGATCGTGGCCCCCATCGTCGTCAATCTCGAGGGCGTCCTCCCGACCGTC
GTCATCTTCAATTTCGACGGGACGGGCCTTCTTATGGGGGCGAAGAGGTGAGGATCCAGGTGAAGGGATCGGCTACGCGGATGTTTTGGTGAGGCAGGAT
CTGGAGATCCTGGGAGGTCACTCGGTGGACCACCGGAGCTGCCATTTGGATCCAGTATGCCTGACGTTTCAAGCGGGTCATGAGGCGGAGATCCGTTCCC
GCTATGCTCTGGATCAGGTTGACTGTCCTGAGGAACTGAATCCGGCTCGCCCAGAGAGATGACCTGATCAGGGACGTCACCTTCAGCAGATAGGTGGTGC
TCCGGGGAATGAGGAGCCAGAGTTTCCTGCACTTTGCAAGACGTGGGGGCGATGCCCCAACCGCAGTGGCTACGATCGCCAAAGCTGAAGGGCGACATCC
CTCTCGATCGTCACAGCGTTGTGATCACGAGCTAAGGCCGATCCTCGGTCGTTGAGGTCGTCCAGATCATGCTGTAGGCGCGATATGGTGCGGCGAGCCA
CGTCAAGCTCCCCTCCTGTGGAAGCAAGTTGTGTGAGTTTCAGATCGATTAAACGGAAGCTTAGGCGGCTGAACGTACCCTGATCGGTTATGTGACCGTT
CAAGCCGACAATCTCACCCTGTAAGCGAGCAAGACCCCGCGTTTTCTGACCTAGACCAGCGTCCAGTTTCGCGCGGTCGTCCAGAGCAACGGCGAGTTCG
GATCGGGCGAGATCTCGGTCCGAATCGGTACTCGCTAATGTATCCCGGAGGCGTTGGAGCTCCCCGTGGGTGGAATCATCTGCCGTAGCCGCCGCTCGTG
CTTGATCTAGCTGAGCACTCCGGATCACCGCCTCGTTCTCAATGGTGTGGAGATCATCGCGTAAACGCTCTAGAAGATCCCCGGATACTCGCAGATCGTG
GTTGGCATGCTCCAGAGCAAGTTCATCTTCATGGCGTTCCTCCTGGGCAACCTCAGCCTCGTCGCCAGCCAACCGCATCTCGCGAGTCAGACGATCGCAA
TCTCCTCGATACTCGTCTCGCTGACGGGAGACGTGGCGAAGCTCACGCTCAAGGTCAGATATGATGGCGGCTTGCCGACCAGCTCTCTGACGAAACTGCA
GGATCGGATATGGCTGGTCACCACCCGGATCGGATCGTGATTGGAGGTGAACGACCTCGTCTTGGAGGCGACCTATCTCCTCCTGCTGGCGATCGCACAC
TCGATCACAGGCCCGCAGATCCTGAGTGAAATCTACGAGGGTCCGCTGCGCGTGCTCCACCCCACGGTGGGCGGTGTCTCGAGCTTCCCTTACGATGCGA
AGCTGGGATGACAGTAACGCCGCCCGCTCGGAGAGATCGTGTACCTGGCGGCGCAGCTGATCCGGGGTGGCGGTGACAAGCGATGTTGGCGGCGATTGAT
CTGACGAGGGCGATGGAGCTCGATGCCCGCCGGGATCCTGGCCACCCATGGAGCGGCCTGAGGCTGACCCAGAGGTGGACATGTGGCGGAAGCGTCAAGG
ATGACGAGAGTACACGACGGCGTGCCCGCAGTGATGCCGTTGCGCGGCAACAACTACGCGCAGGAGGCGGTTGTGGTGAAGTGCCTTCCAGAAAATGCGA
TCGGAAATGAAATGCAGAGGTCACAGTCCCGAGACAATGACAGTTGGACGGATCCGGACTAAGATGGCGATGCCGCCGAGAAAAGGACCAGAAAGGACGA
GGCGAGTGATGGGCCCCGCCATGGGTGCTAGATCCAGCGGGTGATCCAGCGCGCAGCTGTACCAAAATCAAGATCAAGATCTAAGTATACTGGAGGTACA
CCGCGGCTCATGGAACCATCGTTAA