Description :
From Genome Similarity Track
Location :
scaffold_563:16654- 17888
Sequence
1234 bases(100 bases per row)
TTCGATCACCGAACTTCACTTTCAGCTATCGATTTCCGCCGAACACATCCCTGGCAAGCTTAACACAATGGCTGATGCCGGATCCCGTGCGTGGTCAGAG
TCGCACGCACTGTGGTCTACATGGTCTAACTTATCATCGTCATGGCAACAGGTACTCGTGCAAGAACATTACGACGATCTCTGTCGCGTATGGGAAAGTT
TCTGTGCCGTCACGCCTTGGCCACGTCTACTTCAGCAAAATATAATTCACACTGGCAACAATGGAGTCGGTTCTCCAAGTTAATGGGGTGGGCGCCGTGG
TGCCGTCGAAGTGGCAGCTCAAGCTCGCACAAGCTAGCATATTTTGCAATCTACCTGTGGAAATATGGATGGAACAAGACGGGTCATGGCAATCAGTACA
CAACAATCCAGTCCAAGATCTCTAGTATCATTTGGTATCACCGTCGTTTTGGTGGGATCAAACTATCACGATCTCCGCAGCTAGACATTCTGCTGCGCGG
TATCAAGCGTCTTGTCTGCTCCAGTTTCGAAGAAGCAACCTGTGTCACCCGCGTTCTTACGGCTTCTCCATCGGTCTCTTCACATGAACCGACCGCGAGA
TCGCCTGCTGTGGGGCAGCGTTCTTCTTGGGTACTTCTTCTTACTGCGAAGGTCTGAATATCTTGTGGTGGGGAACAGCAGAAAAGTCTACTGCCTGAAA
ACGAGAGATGTATTCTTTGCAGATTCACGAGGAAATCGCATCAACTCCAGAATGGCCACTGCAGTAACAATTGGGATAAGTGGTGCGAAAAACGACCAAT
ACGGCCGAGGTGCATGGAGGACCATGCACAAGACGGGTGATCGACTGCTATGCCCAGTAAAAGCCCTGAAGCATGTATATAGAGCCCGCCAAGAACTCAA
GCGCTCGAGTGACAAACATCTCTGCGCAGACCTCAACGCGGCCACGGTCTCACAGGCACTTAAAACAACGGCAACACGAGCGGGTGTTCCGACTAACAAT
TACTCCTCGCATTCACTGCGAAGTGGTGGGGCGACTGCCTTACTCGCTGGTAAAGCTGACAGTCTGGCGATTAAATTACTGGGGCGATGGATGTCGCGCT
GCTACGAGGAGTATCCAGTTCAGTCAGCAGAATCAACGTCAGGGCTGTCTGCACGAATGGTATAACATAATCATTTCAAGGTCGGCCGAGCACATATCAC
AACGTGGGGCCGCTCACTACGCTCTCGATATTAT