Description :
From Genome Similarity Track
Location :
Scaffold_584:16654- 17661
Sequence
1007 bases(100 bases per row)
CGTTGTATGGCTTCGATGGCTCGGCCGAGCCATTCGCTGACTGCGAGTTGTTCGCGCTGATGCTCTGCTGCTCGCTACTGGGGCTTCGGTCTCGGGACGA
TGCCATGAGTACGCTGTCGCGTGGGTGGAGTAGGAGCAATTGTAGCCGCTGTCGCCTGCGGCTTCGGGAACCCCCATCGGTTGACGGACACTCCTTGGCG
ACGGCGGCAGTCGGATGCTATCGGAACTCCGGGGTTGGTGAAGCATTGTCCCGACGCCAATTCACCTTCGCTCACCTGACGAGTCAATCGATCGATTTCG
TCCTGCAGCGTCACGTTAGCCTTCGCCATCTCAACCGCGCGCTCCTCGCTCTCCTGTGCCGCCACCCGAGCAGCTTTCAATTTCTTCTGCAGCATGCGCG
CCTTGCCATGAACCACCTCGTAATCGTCCATCAGTTCGTTGGCCCAGATGAGAAGTTCGTTATACTCTTCCGCAGTCGCACTTGTCACCAGCGCCGGTTT
CCCATGCACGTCCGCGTTCTTCTGCATATCGTCGTCGCCAGCGTGCAATGGTTCATCGATACACTGCGCCATGGTGTCGTCGTCGTTGTCCATGCAATTG
TTCGCTCCGTTGTCATCGCTGCCTTGGGTAGTGATACTCATGGTACCGCCTACGACACTTACCTCCAGTTTCATCTCCTCCTCGTCCTCCTCGGCAATCT
CGCTGGAACGCACGGCGACTCCGTCCAGCGATTCACAGTGCTGTTGGCCATTAGTCCCCGGCTCGACATGCACACGATGCTCAGAACTGGTGATGTTGTC
ATCGCTCTCCGTGCGAATGTTGACGCCGTTGGCTTCGGTAGCGGTGTGGATGGTCTCATCATCGCTGATTTCCTGCGCATTCAACTCGCAGCCGTCACTC
ATGACAATTCCAGTGCAATCCACGGCAAGCTCTTCAGGTGAGTCAAACTCGGTCGCTAACTCGGCAAGTGGACGGCTTGCATTGCCATCGCGCTCTGTAC
CAACGCG