Description :
From Genome Similarity Track
Location :
Scaffold_7:166521- 167560
Sequence
1039 bases(100 bases per row)
TTTGTAACAGAGCGCTGCCTATGGCAAAGTCGAATGCATCTCAGACAACACTGAAAAGGTACTCAGTATTTGGCAACGGCAAAATTGGAGCATGGAGGAG
ACTCTCTTTTATTACCCGAAATGCGTCGGCATGGGTATTTTCCCAGCGCCAATCGGTATCCTTCTTAAGGATATCACTTAATGGCCGAGCCATATCAGCG
TAATTTTCACTGTATTTATGTAAGTAATTGGCAAGGACAAGCCACTTACGCAAGTCCTTTTTATTCTTAGAAATCGGCCAGTCCACTATAGCTTTGACCT
TAGCGAGATCCGCTCGAAAGCCGCACTTACCAATGAAACAGCCGAGAAAAGGAATCTCCTCTGCACCAAAAACGTATTTAGACGCGTTGGCGTACAATTT
ATTAGTGTGCATGCACTCGAGCACGGCTCGCAAATGACTGATGTGATTTGCAACATCTGAACGATTATGTTCGGCACGACTATGGGCAAAAATGTCATCA
AAGTACGACTGTGCATAATCCCGAGGTGGGCGGAAAAGTTGCGTCACCAGACGATTAATGTTGCCAGAGCATTAGACAGTCCTTGGGACATCACCAGCCA
TTCCCATAGCATACCACTCGGGGTTCTCACTGCTGTAAAAACGGAATATCACTCGCTCGCATGAGCAGTTGATAATATCCGTCGAACAAGTCGAGTGCAC
TTTACATAGTACAACCAACCATGATGTTTTTGAAGAACATCCTTTCGAGAAATGGGTGTCTGTGCCGGAATAGTAGCCGCATTAACCTTGTTATAAGCAT
GTACAATACACTACTTGCCGTTCGGCTTTTTGACACAAAATGTCGGTGTCAAATGTGAAGATTTACTCTCACGTACCAGTCCTGCCTCGTGCTTGGCACT
TGGCACGGAAGAAGTCATCAATGACATCACATTGCTCCTTAGGCAAGGGCCACTGTCGTGTGACACAGTATTTAGTCCCAGGAAATAAGTCAATTTCATG
ACGGACACCTCCATCTGGAGATAGAACCGAGGGTGGGTC