Description :
From Genome Similarity Track
Location :
Scaffold_132:16652- 18163
Sequence
1511 bases(100 bases per row)
TAAGACCGTCCGTAGAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCATTTCGCTCTCTTTAATTAAAGAGGGGGCCTGTGAGCT
GCCGCTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCAC
GCCACTGCGGGTAGACTACCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACAACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAA
GATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTGGCGTCAACACCGGCTGAGCAGCTCGGGCGCGTCAATGCATATGACGCGTACGAGCAG
GGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAG
GGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACT
CTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACACACGGGAAGCAACATCCCCAGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGA
GCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATAC
GGGAGCTCACGGCGTCCCTAGTGGAAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTTCGAGTGGGACCCGCACGCACTCAGC
TGTTCCGGGGTGCAGGCAAGCACCCTTGATAAGGCGATTCAAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGG
CCTGGGAGTTCCTTGTTGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAGCTCGAGTCCGCCGAAACAGCGTGACATCCGCTGCTTCGGC
TGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGGCAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCA
GGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCA
CGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGCTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCC
TTTAAAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGAGAGAAAGCA
AGGGCAACGGG