Description :
From Genome Similarity Track
Location :
Scaffold_88:1665- 3332
Sequence
1667 bases(100 bases per row)
CACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCTTTCACGCGCTGCACCTTA
AGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGTACCCACTCTAACGTCGAGAATCGTGTATAGACAT
GTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTT
GAGCACCCGACCGAGGAACCGTACGGGGTGTAGCTTGCCGTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGA
ACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAGACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAA
CGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTG
CATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAG
TCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCGAATCTTGCTAGCAATCGGTCCCGCGTCGCCAGGCAGCTGT
CGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTC
AGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTTTCTACCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACG
TTCCTTGGCCTGTTCTTCAGCTGAACGCATCTTCGCCGAGTATTCAAACCAACCTCCTTTAGGCTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGC
TGATAGATCATCGGCGCGCGTTTCTATAGCCCCAGAAGGGCATTCTTAAACACTTCTATATGTCCGAGTGCGCAGACCAACGCCGATACTTTACGCCGCT
CGCAAGGTCATCCATAAACGTCCAGAAGCCGCTTGCTGTCATTCAGCGAGCCAGAAACCATAGGTAGCGCTCTAGATTCTGTTTAACAGGTTCTCCACTC
AACGCATGTCATTATTCCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCGGATGTCCAGCTCGTTCTTTTTCATCACAATCACGA
TCGGCGATGCCCATGGACTGTCTGAAAAGACTATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGTAGCGGCACGCG
CCGGGCACGCTGTTTTAATTGGGGCGTGCCCCCTGTGTGTCGATATCGCATAACCGCACCGTAGGCTGGCGGGCGGCAGTGCGTTACCACTAGCAATCAG
GATGTGCTCGTGGGTTCTTTAGCGTCGCGAACCAGACGCTCTCGGGCGTTCAGTCGAACAGCTCAGG