Description :
From Genome Similarity Track
Location :
Scaffold_1962:1665- 3271
Sequence
1606 bases(100 bases per row)
ATCAAACTTGTCATGTGGAGGTCTGCTGTACGACTATTTGCGAGCCAAGAAGAGCGAGAATCGGCTGCAGATGGCGCAAGTGAAGGACGAAGACTAGCGT
GACTGGATCACGTATGAACTGTCCACAGGGCGATGCAGCCTGTGGTAACAGACGAAGAACGTTACTGCAACAACAAATTGTATATGCATTTGAAGAACAA
CATGAACATGATTACGCTGTGGAAGTGGATTAAGAATAAGAAAACATGAATGCCGACCGGAGAGCAACCACTGATAAAACGAAGTCACGCGGGACACCTC
AACAGTTAGCTGAGATGCTGGAGAACGTCGTGGAACGTGCAGCGAGGATTCGAATTGATTCCAAGTGTCTGGCCGCGGTGGCCAAGAGTGTCAACGAAGC
CGAGTCACCACTCTCCTTCTCATCTTCATCAGGAACATGAGCCCCGGCAGCTGGAGCTGCAGCCGGATCCGGCGAATCCTCGGTACCAGCTTCAGGAGGA
GCAGCAGGAGCCATCTCCGCGGATTCAGCGACGACGGGGAGTGCTGCAGGAGCTACCACAGGGAGTGAAAAGTCCGGGGCAGCGGGCGCCGGAGTGTCGG
TTGATGATGCTGCTGTCGGAGGAAGTGCAGCAGACTGAGGGGCGTTCGAACACTCGGTCTTGCCCTCCTGAGAAATAAGTCGAGTGACACGAGGTGATGA
GCAAGGAGCCGATGATTCAGGAGAAGGATGGGCTTACGTACCTCCAGCTGCTCACGTTCGCGACGTCTACGAGGATTGAGACGCTGAAAGGCGTCGGACA
CGGCTCGATTCAGACGCTTGGACATACGGTGGCGAGATGGTGAATTGAAGAATGAAGAAATGTCACAACGGGCGCCAGTACCGTGGCTTCCATTGCGACA
GGGGCAGTTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGTTGTTCAAGCGACGAACCCTCGGTC
AGGTGATGTACGGAGACGCCAAGGTGCAAGGGACACGACGGCGTCACCTCCGAACGTTCAACGAGTATTGGATACGGGCATATGTCACTGAATCCAGGCT
GTCCTTATTATTAATAATGGACTGGCCGGATTCGCATTCAGTGGACCATCTAAGGTACGAACCCTCAGTGGCGGTTGAGATGAGTTCGCGGAAGACTCAG
CTACCCTTGGTAGGCACTTTCACCGTCTGGGACAGGGCGCGGACCGTTAAAGATGCTCATGCGACGGTGCAGACGACGCTTGGCATGCAAGAAGATCCAT
AACGGATCATTGTATACTTGATATTTGTATACTTGATTAGGGCTTTTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAACAGAATTTCCACT
CAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGT
TCATCCGGCAAGGCCAAGAGACTTTGTGTATTGGCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCTT
GAATTG