Description :
From Genome Similarity Track
Location :
contig_31:166480- 169416
Transcript NameFunction/comments
g6070.t1hypothetical protein PHYSODRAFT_565184
g6071.t1hypothetical protein

Sequence
2936 bases(100 bases per row)
GCAGTTTGGCAAGTTCTCCAAGTCCAAGTTCGCGCTCGACTTCCGGTTCCCGCTGGCGCCGATCCAGGCGTTCGCCATCGGCTTGTCCTCCTGCGCCTGG
AACATGAAGGCCACGACCACATAGTAACTCAAAAGCCAGAAAGCAAGGAAGCATGTACCATACCCGAGTAGGACCAGCGACGTCGTCAGCTGCGAACTTC
TCAGCCTACAACTTCAAAGTATTTTAATATGAACCACCTCACCGATGCATCGAAAGCGCTAAGCCGAGTGCATTTACCAAGTTAATCCTGCTTGAACTGA
CCAAACTCTGCTCACTGTTCTGCACCCTCGTCAACTTGATCCGGTGTACTTTCGTCTTCATCAGCCTCGTTCGTCTCGATCTCAACGTCGTCTCCGTCGG
CATCAGGCGAAGCTTCAGCGTTGTTGGATGCTGGTTCATTCTCTTCAGGCGACGCGGCGGCCTCTTCCGGTCTCGTGGCTTCGGTGGCTGCAACATCGGC
GTCATCTTTTTTATCATCGGTCGTGACGACTGTGATGAGTTCCGTCGCCGTGATCGCGCTCTCGACCTCGTGTCTGTGCTGGTTGTCCAGCATTGGCATG
ACTTTGCCCAAAGTTACTGGGTCGGGGGTAAGCGCTCTTCGCGATCTCTTCACCAGCTTCCACGCGTCGGAGACGTGCTCCACAGCAAGGCGGTACTTCT
CGTTCGCTTCAATAGCGTAAGACTTCACTGGGGCCTGCATAGTCTCCCAGGTAAGCTTCCGCTCCCCCGCCACTCGCTCCACGTCATTCTCGTGAATCGT
ATCCTCTGGCCACACGCACGTGAGTTCGTGCGTGTTGTCGATCTTGTTCCTCTGGAAGCCCAGGCCTTCATCTGGTCTGTACCTTCGAGAGACCGACATG
AGGAAGGGCTCCGCAAACTCTGGCAGCATCACCACTGGTAACTTTTCCTTTTCATGGAGGTTGTCGGTCTCCTTGGGTAGCGTCTCGCCGTCTTCCTTCG
CGAGTAGTGACTGAACCAGCTCCACAGGGAACAGCGCCGCTTGCTTCAAGAACGCCAGTATCTGGCCAAGTACGACGAGTACGAGACGGCCGAAGATCGT
GTACAGCAGGAGGCCAAACGTGACTATGAAGCACAGCACTGTCATCAGCATGACGTGAGAGTACACGATCTTGACCAAGAAACCGTACTGGCCCAGCACA
TCGTACTTCTGGAGCTTATCGGCCAGGATGCCGTAGAGCTGATCGGTTGTAGCGTTGGGGTTTTCCTTCAAGACGGACGAAAGCCCCACAGATCTCAGCA
GCCATGGCAAGTTCATCATTGTACCCTTCAGAATTTCAGAGTTGCCGTACATCCACGCTGAAAAGCCCAAGTGTAGCGCCAGAGTCCAAGGCAGTACTTG
GATCGTCACCTCCCCGAGAATTTCATCGTACGTCGTCTTCACACTGTAGAGGTGCAAGATGGACAGCTTGTCGAACCAGTAGATGCCTGCACTGGTGACA
GCAGCAATGAAGAGCAGCACAGGTGACCCACCGCAGAACACCATCGTCACGAAGACCGAGTTGAGCACCATAGGGTACCGCTGTGAGATGTCGAACGTCG
GACCGGCGTACAGCTTGTCCATCTTCACCTGCGTGCGAATTGAGCGGCGCTTGTACCAGCGATAAACCGGAGACACGATGTACATTTGAGCGAACAGCGT
AAACTGCGGCAGGAAAGCGTTAAGCAGCATGGTCGTAGTGATACCCATGCCCACAGTCGGGTACCAAGCACGCTGGAAGTCTTTGTATTTGCCGCCGAGT
AGCTCTTTCGCCACCGGAACAGTGCTCAAGCCGAAAGACGCGTTCACGATGATGACGATAAGCGCGGTGTTCAGGAACTGCGCAATGAACATCCGAACTG
CCACTCGGATCGTCCTGGTCGACTCGCTCGTGTGCCGTTCAAACACCGCAAAGTAGCGCAAGATGTTGTCCAGCAAAAAGTTGACAATGACGACGATACC
GGCAGCAAGAAGAATGAACGAGTTCTTGACCAGGTAGTTCTTCGTAAATCCACGGCATGGGATGTTATTCCACAGCTTCTTGGGGCCGTCGACGAAGCCG
TACTCCTTGATGCTGCTGGTCAGCGCCGTGGAGCAGAAGCAATACAGTACGTGACTGGCGTCGTACGCCTCACAAGACATGCCATCAGACCTGACCAACT
CGTTGTAGTAGAAGCAAGGAAGCGTATTACACACGTCCGTGCTCGTCTCGGAGATGCACGGGTCTACACATCGCTCAGGTCTGGGTAGGCGGAGCCATAC
GACAACCGGGTGGAGTCAAGTCGTTCTTGATCTCGTTGCTGTAAGCGATGTGGTAACGCGTTTCTCCTTTGGTTCCTTCAGAGCATGTCGCGGTTTCATT
CCAATCCAGTGACCACAGAATCGGCCTCTTTTGAGCATTCCAAGAGAAGGACGTGTCCGCGTAGTACACAGCCGGAAGAGAGCGGTCGCAGAGTCCTTCA
GGTGGCATCTTGCTCGCAAATTGCTCCTGCGTCGACTGTGCGGCTGAGATGATCGCGCAGGAAATCACAAGCAGCATAACAGTAATCAAGTTCGTCACGA
ACTGCCGGTAGAAGCGGCCTCGATCGGTCACCTCGAGGTTCTCCACAGGATGTTGGACGGCTCGGGAGCGGTGGTCACGATGAGCGGGATCGTCTCGCGG
AAGTGCAGTACTTGAGGCTGCCATTTGCGCGAAAGCCAACGCGATGACTGACGGTAGTCCTGCAGGCACCGACGCCGAGACTCGAGGTTGTTGAACACGA
CGAAGGCACACTCGCACGCCTCCCAGTCAAACGCTTGCTGCGTGTTCGCAGCTGCAGTCTTTGCCGTTTTCGCTGCAATCTTTGCTGCGTGTGCTGCGCT
CTTGGCCGCTTTCGTTGCGGCCGCGAGCTTGTCGTG