Description :
From Genome Similarity Track
Location :
Scaffold_676:16645- 17705
Transcript NameFunction/comments
g13758.t1hypothetical protein

Sequence
1060 bases(100 bases per row)
ACTCCAGCGCCAGCGCCAGCGCCAGCATTCCCGCCAACACCTGCGGTGCCACCGACTCCAGCGCCAGCACCAACACCAACACTGGCTCCGCCGTTCCCGC
TTACTCCAGCAGTGCCGCCGACTCCAGCACCGCCATAACCATTGCTGTATCCGTTGCCGTATCCGTTGCCGTATCCGTTGCCGTATCCATTGCCGTAGCC
ACCCACGCCGAGTCCAACACCGCCAACGCCGACACCGACACCACGGCCGTACAGCCCAGCACCAGCACCAGCACCAGCACCAACAGCCAGCTCTGCCGTA
CAGTCCCGCACCACCGTGTAGCCCAGCGCCAAGGAGTCCGAAAGTCTGGGCGGCCTCCTCCTTGGCGTTTACTCCGTTCGAGAGGGCCGCGACGGCGAGA
CACAGGGCGGTGATTTTACTGCTGCTGAACATCGTTTACGTTGGTAGTGTGTGTTTGTGTGTGTGTGTGTGATGGTTGTTGTTGCTCTTGTTCTTCGCTC
TTGAACGAGGCTGTTCGAATGCGCTTGAGCTGTTGATGGTGAGCTCGAGTGAGGAGATTTGGAAATGAGCTTCTGTCAGCCAGCTAGTGCGACTCCCATC
GAGTTGGACTACTCGAAATTTGGATCCTAGGCGGCAGTAGTGTTTGCTGCCAGTGGAGGCGGGATGGTGACCAGGTCGTCGGCGAGTATGCGGAGAGCCA
GATGGCACTAGCGTTTTCACCGTTCGACCACCACTCGCCCCATTGCGAGGCATCATCATATCGAGGCAGGTGCCGGGTCATTGTATATGGGGCATATCGT
ATGCCGCATATGGACAAGCCTCAGCTGGCAAGATCATGACTGGTATCGGACAGATGGACAGACGCTGCCGGCACAGACGACGCTGGCCACGCACATCGAA
GTCGCAGCCCGCACGCCAAGCTGTTCGAAAGCGAGCTGGTCGGTCGAGAAACTCGCCAGGGACTCGCTCGGCACTGCCAAGTTGCGCATTGCAGTGCATA
ATAAACTGGAGCCTGTCCGGTGCATGAGCGGTTTTGCACCGGGACAACTTCAACTTCGCT