Description :
From Genome Similarity Track
Location :
Scaffold_11:166437- 169482
Transcript NameFunction/comments
Phyke_g1515hypothetical protein PHYSODRAFT_508656
Phyke_g1516conserved hypothetical protein
Phyke_g1517hypothetical protein PHYSODRAFT_447412

Sequence
3045 bases(100 bases per row)
CGGGTCATTCTGCATGCAAATTCCAGGTCTGCAAGTGAGTTCTCAATACTACAACCATTGGTTACAGCCACACATACATCGTCAGGGATGTACAGAACAC
GGCAGATGATCATTTCCAGGCGCGAAATGAGCGCCATCATGtctccttcagctgctgccaccgcctCCAGTGCTTCGTAGTCGTGTGGACCACGCTTGGA
CACCAGACCGCCCGTTACCAGCACGGCGTCGACGTCACAGTCTTCGGAACTCACCAACTCCTCGCATAGCTGGTTGACGCGCGACGTCTGGCCCTCCAGg
tcgctcagcagcagcagcttgagcttgctgGCGTCACGCCGCATCATTATCAATTGGCAGAAGGCAGACTCAGACTCAGATGAGTATCTGAGTCGGAGTA
ATGCTTGTCAAGCTGTTTATGGCGAGCTCTGTCGCTGAATGCTGACCCCCAACGGTTATACGATGTTGGATGAATGGTACCGGTAACCGCAAGGAGACGT
TGGGGCGTGGCCGTCCGTTCCACACTAAAAAACGTGGTGTGgaatttttgctgtttgttgaTGTCGTGTTTCGTTGGTGGTCTCTTCTGGTTGTGGTCTT
GTCGAGCGTGGCATCTGCAATTGAAGACAAGATCAGCAGCTTATTCGTAACGACTGCTATGGCGACGTCTACTTCTCTCTTTGGCGATAATATCCTTTGA
CCTGAAGAAACCTCCAGCAACGTCGCTTCAACTCAAGGCGTGGAACATCTACGTACTACGAGGCAAGGACAAGTGTAACGCTCCACAGCGGAATTTCAAC
GTAGCAACCGGCTGCGACGAGGAGAGTCGGTCCACCAGCGGCACCACAGCGTATAATTACGGATAATGATATACATTTTAGAAGCTAGATCAACTGAAAT
TCCCAAAACATGCATGCATAGGCCTCTCACCTCGATACTGAACTACAGCACATTATGTCAATTTGTTGTAGGATGAACGTATAGCCGGTAATTGGACCGG
CGGTATACCAATCGTCGACCGTAACGGTTTGTAAGTTCGTTACTTGGGATGGGGAGAGCAGACCAGGAAGGGGCAGTGCCCACACGCTCCACTTCAGCTC
ACACTTCGTCTTCACTTGTACTCAGTGCTCCTGTCGGTCGGCGTCGAGCAGCTATGAACGCTGCACACTACCTCCTGGACCGAATGCGGACGTGCAAGTC
GCTGCAAGAGCTGAGCGACccctccaagaagaagattCGCGGCTGTTTCGAGTCTGTCGGCAACGCCACGCACTCGTTCCATGGCGACGACGCAGTCGGT
TTTGGGCCTGGGTATATGGTGGTTGCAGACGGAGTTTCCGGCACCATGAAGGCTTCAGGAGTGCTGGCTCGCTATCTGGTGGCCGAGACGTTAACGGCGT
TGTCCAAGCTACGCAAACGCGCGAGAGAGACGCCAGCTTGTGCGGCGGACTTTAGCCAAAGCATGCATTCAGCCATCAAGAGCGCTCGGAAAATGACCAA
ACGCAAAGGTCGCTTGGACTCGACGCTTTCCGCTGTTTTCTTCGATGAATCGACGCGGAAGATGTTTGTGTACACCATCGGGGACTGCAAGTGCGTGGTG
TTTCGAGGCGGTGCTCTTGTGTTCGAGAGTGACTCTATCATCTACGACTTTAACGTCCCGGCGGTTGTTTCCAGTAACCAGACAATTAATTACGCTGCAG
AAGTGGAGATACAGACTTTTAGCTACGAGACAGGAGATGTGTGTCTTCTGTTCTCAGACGGTGTGCACGATAACTTGTTCGTGGACGACATTGTGGCTTG
TGTTGCTTCGACGGTGGACTCCACATCGGGTCGATCGAAGAGCAGCGCAGCAGAGGAAATGGCACGCAGGATAGTACAGCGAGCCAAGGACACCTTCTCA
TCAAACACAGGGTACATTCCGTTTGCAGTTTCAGCTGCAGGCTTCTGTCTCGAGGCATTAGGAGAGCTCGAGTCCAACCAATCCGTAGAATCCGAAGAGT
TTGAGAAGTTCCGACAAAAATGCGAGGCGATTCCGTCGCTCGAGATGAAGCGTGCTGCCTTCAGCAATGAACAACGCGTCCGCCAGTTGGCGTTCTACAG
CGCGTCCAACCTGCTGGCTTTCGCACACAAGAAACAAGGCAAACGTGATGACGTCTCTGTGTGCGCAGCTGTGCTCGCCTGAAAATGCTCCATCGGCAGG
CATTCCCTCACACCATGTAGACTGGTACCAAACCCTCCATAACCAAGACAAAAAGCACACCAGTAGCATTGAGGGCGGACGTAGCAAGCTACAATAGCTA
CCCAGGCTCCACTAGGATTACCCCGTATGATATGACTAAATTTTATCAGTAAAACCATCATTATCCAATCtcacttggtttttgtaagGTTATATGACAA
AATAATTTGCTTGGTGGCCAGAAACCGAGCAGACACGTTCCTGACCAGTCCTCAGTAGCATTATGGGCAAGCGATCACGCAACGGACGAGGCGGAGGCCG
CGGGGGTGGCCGTGGCcgtggcaacaagaagccGCGTGCGGACGGCCAGGCGGAGGACTGGCGCGCTGACAAGTTCGCTGATTGGGTGTACGAGAACGAG
AACTTTGACGCGTACTACAAGGCGCAGGGAATCGTACCGGAGGCGGACTGGGAGGCGTTCAAGAAGGCACTGGCTACGCCTCTACCCACGACATTCCGCA
TCAACAGCTCATGCCCTTTTGCTGACCGGTTAGTGACTCAATTAAGGACTAAACTGCGTGTTTTCGACACTAATTTCGTGTGGTTTTGGTGCAATTCTGC
AGCATTCGCGAACACATTGAGCAGGACTTTAAGTTTGACGGTTTAGTGGTGGATGACGAGCCTGTGGAGCCTATCAGCAACATGCAGTGGTACCCTGACA
ACCGCGGCTTCACCTGGTCTGTGGAGCGCCGTCGTGTGCGCAAACTGCCGATCCTCAAGGCGTTCCAGACATGGCTTGTGGAACTCTCGAACAGTGGCAG
CATCACTCGTCAAGAGGCTGTGAGTATGATCCCGCCCCTTGTGTT