Description :
From Genome Similarity Track
Location :
Scaffold_170:16643- 17944
Sequence
1301 bases(100 bases per row)
GCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCGAGCCAGGGCATGCCCAAGATCATATCGTAGGGATCCATGTCGAGAACAGTAAACTGTTCGAGGCTG
TCAAAGTCTTAAAACTTGACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTAACACCGTCCCGTTGCCCTTGC
TTTCTCTCAAAGCATCGGACAACTTGTTGCTGTTGCGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAATTGATCAAGATGCTAAAGGG
ATGATCGTATCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCTATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGG
TACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTTCCGGCGTTCCCCTGTTCCCGGGATCCTGG
CTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAAGTCCGTCTGCGGAGTCTTTCCGCGGGGCAGTCGCACTTGAAGTGGCCCATCTTCCCGCAGCCG
AAGCAGCGAATGTCGCGCTGCTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTAGGGCTCGCTCGACCGGGATCCGACGAAGAACTCCCAGGCCATG
CTGAGGCCGGCGTGCGCGCCTGGCGATGACTGTATTCTTCTTGAAGATCCACTTGAATCGCCTCTTCAAAGGTGCTTGACTGCACCCGGAACAGCTGAGT
ATGCGCTGGGCCCACTCAAAGGCCGTCCATGAAAACAGTCATCTTGACGTATTCGTTGAGTGGGTTTCCCATTAGGGTCGCCGTGAGCTCCCGTATCTCT
TGGACGTACTCGTGCAGCTCACGGACCTCCCCCCCCCTTGCTTGCATGAGAGGAAGCGCGAGCGCTGGCGGTACTTGTAGTTTGCCGGGAGGAACGCGGC
TCGGAGCTGTTCGCACAGCTGAACCCAGAATGTGAAACATCCAGGGGATGTTGCCTCCCGCGTGTACACCCAACGCTTAGTACGACCACTAAGGTTGGAG
AGTGCAAACGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCTATCGCGAGCTCTACCTCTCGGGCCCAGAAGTGAAGGTTCTCGCCTTCCTTCC
CTTCATACGGCTTAACCTTCAGCGGCATTGGCTTCGGGTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGATTCTCCCGCACATGCGCGATGAGGCC
C