Description :
From Genome Similarity Track
Location :
Scaffold_64:166423- 176779
Transcript NameFunction/comments
Phyci_313903Hypothetical protein
Phyci_9638Hypothetical protein
Phyci_584544Hypothetical protein
Phyci_94180hypothetical protein PTSG_09458
Phyci_94181bifunctional folD protein
Phyci_584548Hypothetical protein

Sequence
10356 bases(100 bases per row)
GAGCGAGCGAGACGTCAAGGCGGAGTTCAGGTGCAAAGAAGAAGGCTGCACTCTACTGGACCAATCGCTGTGCTCGTCTTGCTGGAAGAACACACACCAG
TCGAAAGACGGGAAGGAGCACAAGCAGCTCCCAGCGTCGAGTGAGTTTTCTGCGGTGGATGGGGATGGAGGAATTGTGTTGTTAATATTTGTGTGTGTGT
GGCAGTTTGTCCGCAGTGCCAACTGGAGCGCATCGCGTACTGGTGCGCAGAGTGCGACCTGAAGTTTTGCAGAGTCTGCTTTGACCAGATTCACAGCGTG
GCCAAGGCCAAACAACACCGCAAGCTCGCCACGGAAGGTTCGTGCATGGCATGTTCGATGTCGCTGTACTTTGAATTGTCAAATCGTTTGAAAAACTCAA
CCCACCCTGTACGCTACCTCACAGGTGCACCCGGAACCTGCTTGGCAAAATCGGACTGGTCGGCACCTTTTCAGAATGCGATCATGCAGCTAATTACCGC
GCGAAAGCATCCAGCTTCAGGTCCCGCTACTTCTGAAAGAGATTCTACTGGTCCCAAGCGGAAGCGTGAGGTGGAGGTGATCGTTATAgacgacgacgac
gacgatgacgacgaTATGGATGGTGGAATGGCTAGTTCCTCGTCTGCTGCCAATGGAACTCCAGAGGTGCCTGTGGATAGCAGTGACGCTGCGATGAATA
GGCAGAACGGCAATGTCAGAAATGGGGTTATTCGCCCCAGTGATGTGTTTGCACAACTAAACGTGCCGGTGCGAATTGCTCCCGCTCAGTCCCCAGTTGC
TGAGCACTCGACGATTGAGCCCATTCCGTTCCCGCAAGAGCTAACAGGAACAGCACCTTCACCTTCTGTCCAACCCAGCTTGCCGTACAGCTCATCGTCG
ATGCTGAACGGGACCCACACAGCAAACATTAGCTCCAGTGTGGACAGTATGCAGTGGAACAACAGTGTACCTCAGTTCGCCGCTTCAGCAGGACGTCCAG
CCGCAAGTACGGGCTACGGAGCAAGTGCCACCAGCAATGGTATGATGGAGATGTCGTCGAGCTCCGCATCTATGAACTCGGCGAACGGAGTGTGGTCAAC
AACTTCTGCCATTAGCACAGATTTGGCCAGCATGTCCAACCCCACCAGTCTGCTGCCTCTCGGTGGTGCTGTTTTCGCGGAAAACGCGTTGGTTGACTCG
TTAGTGGACCGCTATCACGAGGTGAACCAAACTGTACTTAATTTGGAGCTGCAAACCGAGCAATTCACCAGACAGATAGCCGTCGCAACATGCCAAGGGC
CATTCGCGGCAGGGAACTTGATGGCCAGCCTCAACAGTTTGCAACCCATACTGACGTCAGAACGGAACAGACGTGATAACTTGTTTATCGCGATGATTAT
CCAGTCCCAAGACATCATGGCTGCTGTGCGTCTTCTGCGCCTGACTGAGCTTGGCGACGTGCCGCAAGTCCCCATGATTAGCCATCGCAAATGTCTGCAG
ATATCAAACGAGATCAACCAACACAAGAAAAAACTGATCGAGCTGAACCAGGAGCTTACTGAGACGCTCACCCAGTCCAACGCGGTCAGCTCCAGTTGGG
AAACCTCAGTAATTCGGACGACTAGCGCCAACATTCAGATGCATGAGAAAAGCATCAAGAAGCTGAAGAAAGACCGCGAAGTGGAAATTGTGCGGATTGT
GCAGTTCAGTCGCAATATTCGCGAGACGTTGAAGAAAACGTTTCAACGCACGGTGGagctgcagcgtcagcggcagcaacagcagcagcagcaacaacaA
TTTCAGCAGTATGGATAGTTTTTAGTCTGAAGAAGGGTCCTCGAGTACACGGTGACTTGGTGATCATCAGTTACTGAGCCCGAAAGCGATTGCAGCGAAG
GAGTGACAATGTAGGCAAAGATGATTATTTAAAAGCACTGAATGCGAAAACAAGTAGTTGTGTCATCCGTGTCGATACACGAGGAAGCCGATCTGACCCA
GGAAGAAGTACAGCATCCTACAGGCATCGGAAGGTAAGCCCAGAATTGCAAGTGTGAAATGGGTGAAGGTGAGTGTACTTACTTTTTGACCTCATGAGAG
ACGAAAGAGCCGAAGGACTTGCCGACGATGACATGCCACGCGCCCTCCTGTGTCTCCTCGATTTCGTGCTTGATCTGCTGTGCAACTTCTGTGAAGTGGT
TCTTTTCACCCTTGTACAATGCCTTCAGCGCGTTTGTGGCGCTGGAGAGGATGAGTTCTTCCAGTTCCTTGGATGTATCCTGGTACACGATGCGCAGACC
GCCCACCGACACGTCGTCCTTCTTCTGAGCCTTGGACATGTTTGAACTTGTGTCCGAGCGGATCTTTGGTCGAGAGTGGCGACCGACTGTTGAGATCGTC
TTCCAGCTAAATCAAGGAAAGCGCTGTGAGAGTTTTGGCAGAAGACCATAGAGTGACTCGCCGAGTTGGGGCCATGTCGAGGTCGAGGGACATATTGGAG
CGCATGGTGCAGCAAACTGTGCGCAATGTGCTTTTCCGTGTGCCATCAGACCAACCCACGCGGAGCCAAGCAGTAGTAGCTAAACCTACTGCCTTGGCGG
CCAGTGCAAGTAGCATCGACCACCCTACAGCCCTCAAAACGGCAACCCCAATCGAAATTCGCCCAGACTCGCTTCTTCACCTCCTCGTTAGCTCGAACAA
CGATGGCACCGACAACCCAGCTGAGGATGACGGGGACAACAACGCTGCACGAACTCGTCGCGGATCGTGGATCACAGATTGCGTGAATTGGTCGGTCGAG
CGTCTACAAGCTGAAAAGGCCGAGATCAAGCGCTACCTTCATCAGCATCGTCGGGAAAGTGAAGGCTCCTGTCAGAAGACAATGGAGGCAACCGGTCGAG
TCTCGATCATTCACGAGGCGTACGCGATTCTGAAGCTTTTCCTACTCGAACGGGACCCCGACTATCGCCAGTGTCTGCAGCAGACAATTGGGGGCAGCAA
CTCGTTCCTGACGTCGCTGCATGTGCTACTCACTCTGTACGCGACCTGCTTTGAACGCGCTCACGGAAGACAGGTGCGTCAAACACGTGCCAACCCTGTA
TCCGTGTAACTTCAACGTCTCTTATTCACCTTATGACTCGCATCTACGTTGCAGATCTCCAAGAAAGCCGACGTGAAGCCTATCGAGACGCTCTATGAAC
TCTTCCTCGCTCACCACTGCGCGCCAAAGTCGCAGTAGCTGTAACCGAGTAAAGAGAAATGCACTTGCTTGCACTTTCTTGTTGGTCTTGTGTGATCTTG
TCTTATCTGATGCTCTACACGAATGAGCTGTGCGTGGGGATGATGTCGTCCTTTTTCGAGTCCATGCAGGGCACCGACAGCCACGCGTAATAGAAGGCCG
CGCCTCCCAGCACGTGCATCAGGCCCTTAGCGAGCCCCAAGGCGGCGTGGTTCTCGTCGTCTTCGAAGAAGATGGCGATGACGCCCACCACCGCAGCAGC
GGCCAGGCAGCCCACGCCGTACGTGGCGTTCTGCTTGTTGAGCGGCGAGATGTTGCCGCTCTGCGTGAACAGGCGGCGGTAGGCCACGCCCAGCAGGTAG
CAGACCACGAGCAGCCCCTCGTAGAGCGTCGAGTCCCAGCCGTCCTTGGCCTTGAAGAGCCAGGCGCCCGCGAACGCCACGTAGCGCAGCACGATGTTGT
GGTTCTCGTCCTTGTAGCCCATGAGGTGCACGCAGAGCAGCAGGAAGTACGTGACGGACAGCACGTCCGAGATGAAGTGCCACTCGTCCTCCTTGAGGAA
CAGCTGCGTGTCGAAGGCCTCGGCCGCGTTGAAGCAGAAGGCGATCACGAGCTGGAACACGCCCACGAACAGCTCGAAGTGGCGCCGGTTGCGCTTCATC
ACGTCCAGCGCCGGCAGCATGGCCGCGTCCGTGAGCGCCAGGAACACGAAGCGCCCGAGCTCCAGCAGCATTTTCCCCTGGTGGCAATGGCGAGCGTCCA
GCACAGCACTGCACACGTACGTACGACTCCCCTTCTCGCTTCTAATTGGTGAATAATTGAATCCACCAATCACAGCGCGTCGGGCCAGCATGCACCTGGC
TAAACCGTTGCATCGGTTTACAAGGGGACCTGCTCGTACTGAATGCGAATCAGTAGTCGAACAGAGACGAGCCACTTTTGAAGGTCAACCTCCGGTCACG
GTCTCACTTACTAATTTGCGCAACACCGGACAAGGACCTCGTCGAGCTTCGAGCGCAAGACATTGACACTGTACAATGACCGCCACTGGGTCGAACTCTG
CGCTGCTGCTGGACGGCAAGGCCGCGAGCGACGCCATCCGCGAGCAGCAGCTCAAGCCGCAGTGCGCCGCCTTCCAGCAGCGGCACGGCCGCCCCGTGGG
GCTGGCGGTCGTGGTCGTGGGCGCCCGCAAGGACTCGGCCACGTACGTGCGCATGAAGCAAAAGGCGTGCTCCGCCGCGGGCATCGAGTCGTGGAAGATC
CAGATCGAGCTGCAGCAGGGCGGCGACGAGAGGCCCCCGAGCAGCGTGACCGACGAGCTGCTGCGCACCATCCAGGAGCTCAATGCGCGCGCCGACGTGG
ACGGCATCATCGTGCAGCTACCGCTGCCCGCGTTCTGCGACGAGGACGCGATTCTCGCCACTATTGACCCCAAGAAGGACGTGGACGGCCTGCACCCGGA
CAACCACGCGGCACTCTTCCAGTTCGCGACCAAGAAGGCCGCGAACCAGCATGAGGAGCCACCGTTCGCGTTGCCCTGCACGCCCGCGGGCTGTCTCGAG
CTGCTGGACCACTACAATATCCCGCTGGAGGGCAAGCATGTCGTGGTGCTCGGCCGCAGCCAGATCGTCGGCCTGCCCGTGTCGTTGCTCTGCCTGCACC
GCAACGCCACGGTCACCATGTGCCACTCGCGAACCCAAGACCTCAAGGCGCGTGTGCTTGAGGCCGACATCGTCATCGCGGCCATCGGACGCGCGCGCTT
CGTGCAGGGAGACTGGATTAAGCCCGGTGCTACCGTGATCGATGTCGGTATCAACGCAGTGGAGGACGCGTCCAAGAAGAGCGGCTACCGGCTCGTGGGC
GACGTGGATTTCGACGCCGCCGTCAAGGTCGCACATGGCATCACTCCTGTGCCGGGCGGTATTGGCCCGATGACCGTGGCCATGCTGCTGAAGAACACCA
TCCAGTGCGCCGCGCGACGCGTGCAACAAAAGTAAAGCGGAAGGATACGGCGCGTGAAAAACTACAACTCTTCTTTGGTTTTGGAGAACCACCCGGGCCC
AGCAAGCGCACTACAGCTTGCTCGGTTTTGGCTGTTTGTCCTAGATGGTTAGGCGACGCCTTTAAGTACATCGTCCCCTGACCCTCACCGCTACTTCTTC
CTGTCCGATGATGCCTTAGAAATTGAGATCGTCGTCACCGTCGTGGCCGAAGAGCAAATCCTCCTCGTCCTCTGACGAGAAGTGCCCGCTCTCTTCCACG
AGCTGCACGTCTTGGTGCAGCTCCTCCCAGTACCCGTGCGATTGCTCAGCTTGCGATGCCGCTTCACGATCACCGTCTGCGTCGTTGGTGCTGAGAACAT
CTAGATCGCTGTCCTGATAAGCAGCGTGATTTGAGTGTGTCGAAGCCTGCCTCTGGTGAAGGTGGTTCACTGCTTCTTCCAGCCGTTGCAATGCTGTTTT
CTCACTAGCTGGTCGCATAAGCGTATGCTCTTTCGGTTCACTTGTGGTTACCGCCCCATATCGTCGCTGAGCTTGGAGTAGAAGTCGCATGCAATCGAGT
TGGCCATACGCCGCAGCAATTTGAGCTGGCGTCTCCCAGTCGCTGTTGACTAGCGTTGGATCCGCTCCGAGTGTCAGCAAATTTTGTGCCACTGCTGCGC
GACCAGAGAATGCTGCCCAATGCAATGGAGTATCACCTCTTTCGTCGGCCACGTTCACAGTAGCTCCGTGTTGAACCAATCGAGCAATGATCGGGAGAGC
TGCGGGTGATTCCACCGCGTAGTGCAGCGGAGACCGATGCAGGTCATCGAAGGCATCCACGTTCAAGCCCCCTCCCGGAGTCAGCAGGAACGCTGTCATG
GCGGCATCGTGCGTCAGAACCGCAAGGTGCAGTGCAGTTCGGCCCTGGGCATCACCTTGCGCTTGGAGCATACGATTCCATTCGTAGTTCGCTTCGGTAG
GAACGACGATCTGCTTCGCACACTCCACGAATCCCTTTTCGGCCAGGCAGTGCAGTGGATACCGCCCTGTGCTGTCTGGTGTGTGAAGTGAAAGTGCTAT
TGGCGCGAGAGTTGAAACAACCTCGATCGGGATGATGATCTCCGCGACTGAGTCTTTCATCATCAACTGCTGCAAGAAGCCACAGATTTCAACTTGATCA
TCTTCACACGCTCGGTGTAGTACGTTTTGACCTTTACGGTTGGTCTTCAAGATGTCAGCTCCGTGCTCAAGCAGCTTCTGCATGAATTCGAGATGACCTA
GCGAGGCATATAACATTAGTGGTGTATCGCCGTTGCAGTCGACGGAATTCACGTCCAACTTGGCGTCGCAAGCGAGCAAAAACTCCAACATATCGGCACG
AGCTCGGTAGTTTTCTTTGGAAAAGGAGAGCATGTGCAGCGCATTGCGCTGCATTTTCGGTTCAACCGCTGCTAGGTTGGCACCTCGTTGCTGAAGAAAA
GTGGCGTCTTCCACCGATGCGTTTTCTACTGCAGTGAAGATTGTGACTTCTTTTTTGGCGCGTTGTGAAGGAGAAGACGGCGCAGATTTCCCAATCGGAG
AGGACGGGACTGACTTCGCCACTGGAGACGGTGGCGACTTTGGGGGTTCCTCAAAAGTTGTGTCTATCTCCAAGAGCTGCTGGCGTCGATCTTGGGCGCG
TTGTTGTGCCATTCCCCGCAGCAGTTTAACTGAATAAGGAAGTTCTATCTCTTCAACGTCGTGGTAACGCAGTTCAGGCCTCACGTTTTTGTGGTCTTGC
GCGCAGACTGGGGACTGAAGGATCGGCACAGCGTCAGCCGCGATCTCCTGCAAGACTTGTTGAATATCAGACAGTGCATACTCTTCGCTTGGCTCGAACA
ACTGCAGCAATCTCCGTGTCAGTTGAGAATCGAATCGAAGCCGCAGAATCGCAGCGGCTTGGTTCGTCGTGTCAGTTCTCAAAAAGACAGACTTGGCTTC
GCCACATTCCAGCCAGGCACTAGTCCTCTTGAAGTAGAAATGGAAGTGCTCGGTGTTAAGCTTCCGGTCGTCGTCACATTGTTCACTTGGTAAAGCGATA
TCACCCGCTCGTTGGAAGTAGAGATGCAGCTGCTGTCGTTTTTGATACTCACGAACGCACCTTTGAAGCACCGCCGCAACATCATGGAAGAACATGATCT
GGTTCATGCTGCGGGTCAAAATGTGGGGAAGCTCTCGGTGGCTCCAACTATCAACTATCATCTCCACACCAGCACGAGTAACATCCTCCTCTGGAATCTC
CATCAGTTCTTGGTCATCTTCTGCAGGTTCTCCAATTTGAGGCTGGTCACCGACTGGTTCTTCACTAAGAGGTTTCTCGGCCGGCTCTTCATGCTCAACC
ACCACTTCCTTCTCTCCAACCTCCTTCTCGGATACATATTTGATATCTTGCAATCTCCTTCGCGAAGCTATAGCTCTTTGAATTCGCTTTGCCGCCAAAG
AACGCTTAAGGACAAGAATTTTGCGTTCAAGAGCTTTCGTCTCTTCAATCATGCGAAGCTCATTATCCTTGACAACTGCACGTTTAACTTGTCGAACTCC
ACCGTGCCATCGACGCCAGCAAACCGGCAGTTTAGTCACGAGTACCGATACTGCCAGTCGATAGGCACGAACCTCTTCAGCGCGTTTTGCTTCCAATGCG
TCTAAATAGTGCATCCGATACAGCTTCGCCTTCCACATTGCTTCGATTTTGGTCGCCGCACTATCTTGTCGTCGCATCTGAAGGTACTTCTTGACCGCAC
GCGCGATACATCTACCATACGTTCGGTGCTTGATGGTGTCTAGCTTCTCATCGCGTTCCTGTTCGTTTTGAAGTTTCGTAGCATCGGAGTGGAGTTGTTG
TTCTGCTGTCGAGCTGTCAGCTGACTTTTGTTGGTTGGCACTGCCACTTTTCCCCCTGCTGTGTTGTTCACGCTGAAGATGATACCACCGTCGCCAGTTC
TTTTGAATCTTAAGAGCACTTAAATTCTGCTTGTGCCGGAGACGCTCCTCGGCCAACCTCCGTCTGTGATGCGAGATTCTCCAGTGTCGCTGATTCTTGA
TAGAGCTTTCGTACTGCTCTTGACGAATGAATTCTCTTTCAAGCTCTTCTTTCTGTTCGTGATGCCACCTGAGCCAAAGCGTCTGAATTTTGAGCGCCGC
CATGTATTGTTCATGCTGGATGCGCTCTCGCTCCATTTTGCGGCGATGCTGTCGTATGCCCCAGTTCCGCTGAATTTTCAACGAGCTCGCGTTTTGTGTC
TGCTTTACATGTTCCAGCTCTTGCTGTTCGCTTTTGGCTATTTGCACCTGAGTATCATACTCGTTTCGAAGTCGTTCGTCTTCCAGCGCCAGACTCTCCT
GCGCATTGCGTTCCTGTCTCAACCGAGTCAGTTCGTTTCGAGCAGATTTCACTGATTCCCACCTTTTCCAGGCTCGTTGAATCAATACCGCACTCATACG
CTGAGCTTCCGCCTCAGCGCACGCTTTAGCGCGTTTTTCTTCTTCTTGGTTCCGTCGAAGACGTTGCTTCGTCCAATTCTGCTGAATTCGGAGCGCTATT
GCACGCTCTTCCTTCTTTTGCTTTTCTTGTTCCGCTTTCGTTAGAGACCGCTGACGCCACCTTCTCCAAGCTCCCTGAATTCGAAGTGCAGATCGTAATA
CTCGTCGTTGGGTTTGCCTTTCCTTCCACCATCGACAGCAAGCACTTTGTATCTTTGCCGAGCTGAGTTGCTGTAGATGACGCTTTTGATCCTGCTCTTT
TTCAAGTTGTCGCTTGTGCTTCCACCGACGCCAAAACTGCTGTATAAGTCCGGCAGCCAGCATTTGTGCGTCTCGTACGCGCGCTGCCTCCTTCTCCTTC
TGCCACCTCTCCCAGCGCTTTTGTATTCGCCCTGCGCTTCGTTCTCGTCTCTGTTTCCACTGACACCACATCTTCCACAGTTTCTGAAGTTTTCGAGCAC
AGGCCTGTCGTAGAATCCGAAGGCGAGTCATCTCTCGCTCGGCCAATTTCCACTGGTGCCACTTCTTCCACGTCCTTTGTATCACGCGAGCGCTTGCATT
ACGCAAAATTCGGGTTCGTTCAGCCTTTTCTCGCTGTTGCATCTGCCATTTCATCCACCATTTTTGTATGCGAATAGCACTTGAGAGAAGAAGTTTTTGC
TTTCTCTGAGCCCAACGTCTCCATGCTCCTTGAATTTTGCGTACGTTGGCCCGTAGTAGAATTGCTTCCAGATGTGCATTAAGCATCAGCTGTTGCTGGT
GCTGGCGCTCCTGTTCGCGTCGTATCCATCGCCTCCAGGATCCTTGGATTTTGCGAGCGTTTGCTCGAGCTCGTATTGCGTCCAAATGAGCATGAAAAGC
TAATAGTTGTTGACGTCTCCGCTCATATTCAAATTGAACCCACCGTCTCCATGCTGCTTGAATTTTACGCACGTGTGCTCGAACTCGTATCGCTTCAAGG
TGCTCGTTAAATTCTAGCTGTTGTTGCTGTCTTCGGTCTCGCTCACGAATGGACCACCGTCTCCATGCACTTTGAATCTTGCGAACATTGGATCGAGTAC
GGATAACTTCCAGGTGTGCTTCGAAAACTAGTTGCTGCTGTTGCCTTCGGGCTCGCTCGCCTGTCACCCACCGTCGCCACACTACCTGAATTTTGCGTGC
ATTTGATCTGACACGGACAGCTTCCAGGTGGGTTTCAAACGCTAATTGCTGTCGACATCGACGTTTTTGTTCACGTTGAACCCAATATCTCCACACACCC
TGAATTTTGCGCGCATACGCTCGATCTCGTATCGCTTCCAGATGTGCCCGGAACACAAGCTGCTGCTCACGCCTCCGTTCTCGCTCACGCACTACCCACT
TTCTCCAGGCATGTTGGATCTTACGTACGTTGGCTCGAACTCGTATCGCTTCCAGATGAACTTCAAATGCAGCTTGCTGTGCACGCCGCCGCTCGTTCTC
ACTCCGGACCCAGCGTCTCCACGCTCCCTGAATTTTGCGTACGTTTGCTCGGACTTGAATCGCTTCTAAATGCGCTTGAAACTCGAGTTGCTGTTCTCGC
CTTCGCTCTCTTTCGCATGCAATCCAACGATGCCAACAACCTTGAATCTTACGAGC