Description :
From Genome Similarity Track
Location :
Scaffold_1389:1664- 3739
Sequence
2075 bases(100 bases per row)
CCCCCCTGGAGCGCCGACCTTTTACATACGCAAGCTAGTGGGCTGGCGAATTGTGCATGACTATCGGGTCATGAACGAGCCCACAATTTGTCAATCTACG
CCTATGCCACGAAAAGACGATATTTTGGATCGGATGgccggttgctgctggtatAGTTGTTTTGACTTGCTGTCAGGCTATTACCAGATTCCATGTTTTG
ACTTGATGTCAGGCTATTACCAGATTGCATGCGCAACAGTGACATACCTCGGACAGCATTTCAAACCCCGGACGGTCTTTTTGAGTACCTGGCTGTATCC
ATGGGGTTGAGCAACGCCCCGGCAACATTTAATCGCATCTGCACGACAATTTTTAAGGACCTGGCGGACTGAGTGGCAACCTAATTTGATGATATCTACG
TGATTacgagcgacgaggacatcGATGTCCACCTTCAGGCAGTCGAACGAGTTTTTCAGCGCTGCTTGGACCATAATATTTACCTCAAACTCGTGAAATC
AACGATATGCAGCCGTGGAATTCCTTGCCTTGGAGATTTCGTTGGACTCCAAGGCGTCCGCATTGATCTGGACAAAGTTGCGGCCATTAAAGACTGGCCT
CCACCACGAACTGTCAAAGATTTGCAGACCTCTTTGGGGATGACGGTCTACGTAAAGCGGTTCTGCCATAACTACTCAGAAATCAGCGCTCCGCTTTTCA
ATTTTGTTAAGTCTAAAGCAAAAGAGCTTGCTTGGAATTCTGTCGCGCAAAGTCCATTTGAAGCACTCAAATTGGTACTGAGCAACACACCCGTGCTGGC
CCTACCCGATTTTTCCCGCCCTTTTCGTATTCGGACTGACGCGTTACAGTTTGCGATCGGCGGTGTGCTTTTCCAGACAAATGTTTCTTCAGCGAAGGTC
GAGCCGCAGCAAGATGCTAGTGGAAATACAAGTAAGGGGATCGAAAGCCCTATCGCGCTCACAGGACGGAAACTCACATCAGCAGAGCTCAATTACCCAA
CGCATGAGCAGGAGATGCTAGCCATCATTCGTTGCTTTAACATTTGGCGAGTCTACCTTATCGACGGAGGATAAACTGTTGAAACGGATCACCGATCGTT
GGAAAAGGTTCTCACGCAAAAAAGTATCAATCGGCGCATTTGCCGTTGGTACGATCAACTCGCTTACTACTATTTAAAATTCAGCTACATACCTGGCGAA
ACAAACACGGTTGCCGATGCGCTGAGTAGGCGCAGTGACTTCGAAGTCGATTTCCTAGCGCAGAAGAACAAACAGATATTTGGCAGTCAACGTCATTGAT
AGAATTGATTCGACGGGCCCAGGTGACGGAACAGGTGATACTACCCAGCTtaacgaagaagaagaaaccaCCGGTTGTAGATGCTGAAGTCGAAAAATTG
GTCTTCTATGACCTAAATGGGACGGCTCGTATCTGGATCCCCCAAGAAAACGTAGAAATTCAAAATGCCGTTCTCTGGGAGCTTCATGATAGCGTGCTTA
GTGGGCATTCTGGGATCGAGAAAACAATCCGTGCGGTGCAGGAAAAGTTTATTGGCGCAGCATGGTTCACAGCATTACGTCAAGTCGTGCCAGCCATGTC
AGCGAAGCAAGGGAAGAACCGGAAAGCCACATGGGTTATTGCGTCCCCTGGAAGTACCAACAGCAAGATGGGAATACATTGGTATGGACTTTATTACTGG
TCTTCCAATGAACGGTAAAAACAACAATGCGGTTTTGGTCACTGCTGACCGACTCACTAAACGAGCGCATTTCATTGAGATGAGCACGAAAATTTCAGCT
GAAGACTTCGCTTACCTGTTCTTGAATGTGTATGTGCGCTACCACGGAATTACTCGTGATATCACGTCAGATAGAGATTCAAAGTTCACATCCAAGTTCT
GGCAAGAATGCGCAATGCTAACCGGTACAAAGTTGCGAATGGTGGCTGCCTACTAGCAGAGAACGGATGGCCAAGTCGAACGGATCAATGCGATCTTGGC
GGCATATCTACGAAGTTACGTGAGTGTATACAACAATGGTCAGACTATTTGGTTCTAGCTGTATTCGCGTACAAC