Description :
From Genome Similarity Track
Location :
Scaffold_1637:1664- 3446
Transcript NameFunction/comments
Phypl_g13869hypothetical protein PHYSODRAFT_478939
Phypl_g13870hypothetical protein PHYSODRAFT_486841

Sequence
1782 bases(100 bases per row)
TGCGGCGTGAGCAATGGCGACGGGGACCCGGTGTGAGGCGCCATGTTTGCTGGGCAACGCTGATTGATTTATGAAAGCGGACGGCATCGATGAAAGGTGT
GGCACTGGGTTCCGAATTCCTCCCCAGCAGCGCTCACCCATGGCCCCCACCAGAACGATTCTACAATCGGCGCTCGCGTTGCGCGCCTGCACACGATCCA
AGATGGGCCAGGTCAGCGCGACCAGCAACGCTACCGGCGGGCTTTGATCTCTGGCTACTTGCAATTGCATACACATGAGCCGAGTGTGTTCAGTCCTGCT
CATCATTTGGCGGGCTCCGATGACGAAGCAGGTGAATGTACCAATGGGCTGGTGAACTCCGCCGCATCCGCGACAGTAAGCTCATCTTTGGCTCAGCATT
GGCTGTCGATGGCTGCCAATTCCTCCAGTCGCGGCGCATTGTCGCTGGACTGGGCCACGATCTACGTCTCGGTCGCGTTCACTGAGCACTTTGCGTGTGG
CCATTGGCCACTGGCCAAGACCACATGCATCAAACGTGACGGCGGGATGGACACTCGGGTGGTCGATGACAACCCAACCGTCCACCGACTTCGCCGCGGC
TATGCAAGGCGGCTCAATGAAAATCGACAATGGCCCACATCGCATTTGACAGTCTCACAAGTCGTGTCACGACTGGCTGTGTGACGCGACCCAACCAGCG
CCCGAGCACTGCCCCACGTGTTACCAGTAGAGTCTTAGTGGTTGAAGCTGTCATGGATCGCACCATCTCAATGCCTCTTCGAGTCGAAGACACAGTCAAG
GTCGACCGTGTGATGTTGCGTGTACTGCGCTTCCTGATGAACACTTTGAGCCGATAGCCAACATGGAAGCCAATATTGTGAAAATCCGCAGCCTGCGCGT
TAAACTTCTCGCTGCTCACTTCCAAACTTGCCCACTCCAACTCCAACCATGGCCCCCAAGAATACCGACGCCAACACCAACACCACCTCCGCTGGATCCA
CTGCAGTGGCCTCTTCGCCCGCCCCCATCAAGAATGCGCTCAACCTCGAGGTCGAGCACGCCCCGTTCACCCACCCCGAACTGCGCGGAGAGTTCCCCAC
CAAGACGTACGACCCGATTCCCGTGCTGCCGTACGAGGAccgcgcgctcaaggccgacTCGACCTTCAAGagcctgctggccgacgcgaCGGTGACGCAC
CTGGAGCCGAAGATCGGCACGGAGATCTCgggtctgcagctgcacgagctgatGAACGCgcagaaggacgagctggcgctgctggtggcgcagcgcggcg
tGGTGTTCTTCCGCGACCAGAAGATCTCGATCGAGGAGCAGTTGTCACTGGGTCGCTACTATGGCCCTCTCCACGTGCACCAGTCTGTCGCTCATGCCAA
AGGTGTCCCGCAGgtgcacgtggtggagaacaCGCTTGAGGGCAGCCAAAAACGCATCAAGTcccaggcgctggagccaGTAAACCTATGGCACAGCGAT
GTCTCGTACGAGCGCCAGGTGAGGAATAATGGTTGTGAAGCTGTTTTTTGTTGGTGTTCTAACTTTTTTGCTTGTTGGCAGCCACCGTCGTACACGAGTT
TCAAGGTCTTGACTACCCCTCCAACGGGTGGTGACACCCTATGGGCCTCTGCGTATGAGGCTTACGACCGACTCACTCCGCAATTcaagaagttcgtgga
ggGACTCACGGCCatccacagcagcaaggtACGAGCTGAACCATGACTCTAGTCATCTTCTCTTAGCAAACACTCACCACTG