Description :
From Genome Similarity Track
Location :
Scaffold_20:166326- 172464
Sequence
6138 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTATCTATTCTCATTAGACGAAGAAATCCATATAAATTATATTTTGAGGAACCCTGATGCTGAC
CCAGGTTATTGAAATTAAAAATATCGAGACGCATAGGGACATGGCGTTTTTTTATGTCAAAACATGAACTAAACCTAAACTACCGTCGCGTAGCGGCGGC
GCTCGGCGAGTACCAATGTAAAGTTGCAGGTGTGAGAGAGGATCGTGACCATCCTTGTACTGTAGTATATGTGTGAGTTACAAGCATCATCACATTTCGT
CATAAAATGATTGCTCTCTATTACGATACTTTTGTTGTGCGATCATTTCAAAAATCAGACCTCCACTCCAGCATTAAATTCCAGAGAGCTTTGAATTCAC
ATCATAGAAGACGGAATAGATCATGTTCACGAGTTCCATCTAGCCTAGTTGAGCTCTCAATTGAGATATTTATTACTATTAATGTACACTTCACAGACCA
GTATTTTGTAAGAGCTCTGCGATGTTATTTTCCACACACTATTCAAAGTAAAGACGATATTAATATTATTAATATAAGCTTCACAGGCCGCATTTGTAAG
AGCTCGGCGATGCTATTTTCCACACACTTTCTAAAGTAGTGACGATAGTATTTTTTTAAATTAAAGTAGGCTTCACGACCAGCGCTTTTTATAGGGACTT
TGCGAATCTTTTTTACTTCACCTGGCACTCACCACTGCCACGCGGGTGCACGGTCATTGCGCTATCTGCTCCCGTGCACCCCACCCGACGAATGCATGCG
CGCACGATAGATAGTTGTTTTAGTCAATTTATATTGCATGTAAAGTATGTATTTGTTTAAAAATCTGATAATAATATATTATAGCAAAGCCAAATAATAC
TTTTTTAAAACATTTTAATATTTTGCCTAATGATAAATACCAGTCTTCCAGTACCGTGCTATTGGCTAATGTTTGGACGCAAGTAATTGGTTAAAACAAT
AAGTTTTGCTAACTTACTCACAGTTTGCAAAATGGTGGGCCCTGTGTGCAAGCAATGCGAGGCGAAGATTGACCCGCTTCTGCTGGACCCGCAGTGGTCT
ACGACGGATACCCGGGCGCGTTGCGTCGGTTGCGGGAAGCTGCAGTACGGTTACGCGCTCCCTACAATCAGCGGACGGGGCAGCGTGCGGCACTGTATGG
CGTGCAAGAACGGCCCAAAAGCGGTTAAGCTCTGGGAGGAAAAGCCCCAACCACCTGATTCGGCCAAAGTGCGCCGCCAGGAAAGCCTGGCGAGCGTCAA
GAAGGCGATGGGTCCTGACTGGTACCCCAAGAAGAAAAAGAGACGCAGCCGCCCTCGCAATCTGACCGCCCGAAATGCCAAGTACATCGAGCAAAAGAAG
CAGCAGAAGAGCAAATAATTGGTAAAAAAATTTTACAAATGGCTCTTTATTAATAATTAATAAAGAGCCATTTGTAAGAAAGGGATGTAATCAGTGTTAT
GTGCATTAAAGCCAGAAAGAAAAGAGAGGCGTTACTGCAACCACAATACGACACGACGACAAGAAATTTCCCGCCACCTAAACTTGCAGCCAATAAGTCC
GTCCGGTTCCTTTCTTGCTGCTTTTTCCTGCCTTTTCGCATGGCTACACTCGGTCTGTCTCATACAGTTTCCTCCCATCCTACCGACCGCGCCTATCTTT
CTGACTTGACTTAACTATGCCTAAACTACAATTATGGCCAAAAAGCGGACACAATTAACTCGGGGCCTGATTGGGCAATACCTGCCGACCTGCGACACTG
ACTGGATCTGTCGCACGATCACCCTCTCCTCTCTTCCTCGCGATTGGACGTAAGTTAAACATTTTTGCCGAGCACGAAACGCATCGATTGGTTGCAAACA
GCCAGGCGAGCTGTGCAGATACTTGATTATTGACGCAAAACCTGTCGTATGTACTGAAATCGGGCACAGTAACCACTTCATTTTCTAAGAGCTCTCAATT
GAGATATTTATTACTATTAATGTACACTTCACAGACCAGTATTTTGTAAGAGCTCTGCGATGTTATTTTCCACACACTATTCAAAGTAAAGACGATATTA
ATATTATTAATATAAGCTTCACAGGCCGCATTTGTAAGAGCTCGGCGATGCTATTTTCCACACACTTTCTAAAGTAGTGACGATAGTATTTTTTTAAATT
AAAGTAGGCTTCACGACCAGCGCTTTTTATAGGGACTTTGCGAATCTTTTTTACTTCACCTGGCACTCACCACTGCCACGCGGGTGCACGGTCATTGCGC
TATCTGCTCCCGTGCACCCCACCCGACGAATGCATGCGCGCACGATAGATAGTTGTTTTAGTCAATTTATATTGCATGTAAAGTATGTATTTGTTTAAAA
ATCTGATAATAATATATTATAGCAAAGCCAAATAATACTATTTTAAAACATTTTAATATTTTGCCTAATGATAAATACCAGTCTTCCAGTACCGTGCTAT
TGGCTAATGTTTGGACGCAAGTAATTGGTTAAAACAATAAGTTTTGCTAACTTACTCACAGTTTGCAAAATGGTGGGCCCTGTGTGCAAGCAATGCGAGG
CGAAGATTGACCCGCTTCTGCTGGACCCGCAGTGGTCTACGACGGATACCCGGGCGCGTTGCGTCGGTTGCGGGAAGCTGCAGTACGGTTACGCGCTCCC
TACAATCAGCGGACGGGGCAGCGTGCGGCACTGTATGGCGTGCAAGAACGGCCCAAAAGCGGTTAAGTTCTGGGAGGAAAAGCCCCCACCACCTGATTCG
GCCAAAGTGCGCCGCCAGGAAAGCCTGGCGAGCGTCAAGAAGGCGATGGGTCCTGACTGGTACCCCGAGAAGAAAAAGAGACGCAGCCGCCCTCGCAATC
TGACCGCCCGAAACGCCAAGTACATCGAGCAAAAGAAGCAGCAGAAGAGCAAATAATTGGTAAAAAAATTTTACAAATGGCTCTTTATTAATAATTAATA
AAGAGCCATTTGTAAAAAAAGGGATGTAATCAGTGTTTATGTGCATTAAAGCCAGAAAGAAAAGAGAGGCGTTACTGCAACCACAATACGACACGACGAC
AAGAACTTTCCCGCCACCTAAACTTGCAGCCAATAAGTCCGTCCGGTTCCTTTCTTGCTGCTTTTTCCTGCCTTTTCGCATGGCTACACTCGGTCTGTCT
CATACAGTTTCCTCCCATCCTACCGACCGCGCCTATCTTTCTGACTTGACTTAACTATGCCTAAACTACAATTATGGCCAAAAAGCGGACACAATTAACT
CGGGCCCTGATTGGGCAATACCTGCCGACCTGCGACACTGACTGGATCTGTCGCACGATCAGACCGCCTCTCTTCCTCGCGATTGGACGTAAGTTAAACA
TTTTTGCCGAGCACGAAACGCATCGATTGGTTGCAAACAGCCAGGCGAGCTGTGCAGATACTTGATTATTGACGCAAAACCTGTCGTATGTACTGAAATC
GGGCACAGTAACCACTTCATTTTCTAAGAGCTCTCAATTGAGATATTTATTACTATTAATGTACACTTCACAGACCAGTATTTTGTAAGAGCTCTGCGAT
GTTATTTTCCACACACTATTCAAAGTAAAGACGATATTAATATTATTAATATAAGCTTCACAGGCCGCATTTGTAAGAGCTCGGCGATGCTATTTTCCAC
ACACTTTCTAAAGTAGTGACGATAGTATTTTTTTAAAT