Description :
From Genome Similarity Track
Location :
Scaffold_100:166326- 167652
Transcript NameFunction/comments
Phyin_T30-4PITG_19351Kinesin-like protein

Sequence
1326 bases(100 bases per row)
GCTTTGTACCGTGAACGTGCAAGATTGTCAAGGCATTCCGTACCTGTGCACTTTTTCGGAAGCGGACGATCTCTTCCTTTTACCGTGAGTTGGAAGCGAA
CGATCTCTTGGTTTTGTCTTGAGTCCTGGAGCTCCATCCCTTTGATCCAAGGCCGACAAACTGAGTCGTCTTGAGAAGTTCGTCGGGGGGGAAATTCCAC
TCGGTTTGCCATTGATCGTCGTTCTGATCTCTGCAGTCTCAGGCGAAGACTCGTTGCCACGTAGAATATTCTCCGCGACGTTTTCAATGCCATTTCGTCC
CTGGGCATTGGCAAGCTTCTCCCTGCTTCATGCATCCATGCGTTAGTCACTCGCATCAATTTGAAATTGCAGGGATCGACTGCTACAGCATGCCGACCGG
CTTACTTTCGAGCGAACAAACTCCACCTTCGCGAAGAGATTGGGGGTGGTAATTCTGGCGGGGAAGGGGTCCTCATCTGCTGCAAAACTCTCCTGGCCTC
GTCTCCCTTGGTCCTGCGGCGATGCTCCTCCTGACGGTACTCCTCGAGCCTCCTCTCGTACTTCTTGCGCAGCTCTAGCTCCGCTGTCAGTTTTTCTTGC
AAAGCTTGAATTTGAGAAACCTGGTTGGCAACCTGCAGCCGCAACACTTTAACGTTAGTGTGTGAAGACTTGAGACACGACAGACTAGCCTTACCACTCC
GCTCAGTCTCGTGATCTCCGCACGCTCGGTACGACGCGACTTGCCCATCTGAATATGACTCACACGCGACGCAAACTTGAGAGAATTGATGGTCTCATTC
ACGTCTGCACTTCTGGGGCTCACGTGTACAAGTAAAAGCGTACGGTTGGCGTTGCCACTCAGCGAATCCTGAAGCAAGTGCGTGAGCTTGGAGTTGCGGA
ACGGGATATGCTTCTCCTTCGCCAACAACGCGGATAAAACGTCGCCCACAGCTGCCAGCGACTTGTTAATGTGCTGCGATTCCCGAACGGAAAGTGGAGG
CGTCTCCGCCGTCTTCGAGAGTCGTTCCGATCCTGCCAAGTCCACGAGAACTAGTCTGCCTGTTTCTGCATCTCCATTAACCTTGCTGATACGTTGAATC
TCAATCGTCACAACGGTATGCGACCTGTTGCTGCGGTCGTTCTTCTTCGTCTTGGTTCGAGCAATAACCTCGTGAAATTCCTTGGCACTTGGCGCATGAA
CTGTCTCCACATTCTTCAAGTAAACGCCATTCTCGCCATGTCGGATCTCCAGTGTAGACGACGAGCTGCTCTGCTGGTTGCCACACATGCTTGTGGCGCC
GACATGGCAGCCCATACTGGCGTTCG