Description :
From Genome Similarity Track
Location :
Scaffold_14:166222- 167448
Sequence
1226 bases(100 bases per row)
CGACGCGTTATCGCGTCGACCTGACTACGCTACGACTGATGCCGACGTCAATGCCATTGACGCCATGCAATCGAGCACCCCAACGTCGTCACTTTTGAAC
GACGTGAAGGGCACGACGCGGACGCGAAGCTCTTGCTGGCCTTCGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCATCGTGCTCG
TGCACACCGTTACCGGGTGCACGGCGGGTTATTACTCTGCAGTGCAGTCGACGGCAACGCAGACCGCGTTGTCGTGTCCAATGACCATGACCTGCGACTC
AGGATCATGTATGAGTATCACGATGCACCGAATGCAGGGCATCCGGTCCGTGAGAAGACCTACCTTCTTCTTACGCGGGACTTCTACTGGGCCCACCAGT
ATACATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTGCCGACTCCGTC
GGAATGTTGGCAGTCCATGTCTTTGGACCTCGTGTTCGGTCTTCCCCCGGACAGCCAGGAGAACACAGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAG
ATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTCGACTTGGTGTTCAAACACCATTGCATGCCGATCGACA
TTGTGTCGGATCGAGACCCGCGCTTCACTGCGCACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGCCAACTTTCGATGTCGACTGCGTGCCATCCGCA
GACGGACGGGTACACCGAGCGCGTGAACCGCGTGCTCCTGAACGTGCTTAAGAGCTACGTTCACTCGTTCCAACACTGGAGTGAGTGCCTGCCGATGGCG
GAGCTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACGCCGTTTTACGTGAATGTCATGAGGCACCCACGCCTCCCGAGTCTACTCAGGATGG
TGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGAAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACCACGCTTAAGAA
GAACAAGAAACACGCGTCTGTGCAGGGCACAGACGCCAACAAGAGCAACAACAACAGGAAGTACGGGTATGTACCGGGCACAGACACCGCCAACATGGAC
ACAGAGGCCGGGCCTACTGCTGGAAG