Description :
From Genome Similarity Track
Location :
scaffold_14:16622- 19901
Sequence
3279 bases(100 bases per row)
AGAAAATCCCTTTCCTAAATTTAGGATATTGAGATGGCCCTTGCTCCACGTCTTGATTGCACTCTCCAACCTAGGCGATCAAGCGATAGAATGAGATCTT
ACGTATAACTCCTCGGCATAAAAGACGTTCCCATCGGGCAACTTAAAGCGACAGATGTCGCCGGTATTCGCACCGCGGAACCAGTTGTATCGGGTGTGTT
CGGACTTCTTGTCTGCTCGTTGAAAAAGGTGAGAGTTGGCGGACTGTGTCCAGAGTTAGGAGCTTTGGTGTTTGATCCTCTTAAGGAAATTTCTACCATC
TTCGTTGAGGGTCTTAAATCGCTGCGGCTCGTATCTAGACAAGACAATCCACATACTTTCTTTCAAGTAGCGACGGGTTCGTATATTCATACAGAGTACG
ACTTCCGTGCCGCAAGAGCTGATAATATAAGCTTCACGAGCCAGCAGCAATGCACCTCAACCAAGCTGAGGAAGGGACCAGAAAAATATTAGCTGCTGAA
CGGCACCGCAACATCCACAGAGGATGAGTCTGCGGCAGTACAATATATCTGCAGATTGATACCCCCTTCGTTCTCATCTAAGATGTTTGAAATGTCGGTC
TCCAACAAACGAGCGAACTATGAACTCTGACAAGAAAAAGACGTACATCAGTGGGCGCAGGGGAAACGTCAAGGAGGGGCTGTGTATTCTTTTGTACCTT
GTGAAGGTCGTGGAAAATGGGAACCAGCATCTAAAGAAAAGTGGCTTTTTTCAGAGAGTGGCACTAAGAGTCCGAAGTAGTTCGTTGGTAGATGATATTG
ACGACCTGGGCCCAATGAGGACAAGAATTGATCTGATACATTCAGAAGCGTCCTTCAATCACAAACAACGCGCGCCTTTTAAAAACGGTATACTAAATAC
GGAGGCATTAGAGGTGCCAAATACGGATACAATGTCCGTTGGTCTTGCGATGAGGATAATGGTCAGGATATCGGAGATTCTGTTAATGCTTCAAAATATT
TGacgactttgacagcgtggaatgctgtctAGCTCTGAGCTAAAATTGTGATATACGATCATATCCCGATGTAGGATGTGGCTGGAGCGCCAAGAGCGGT
GGATCGGCTGGATGTCGTAAAGGTATGTTACCACGTACTTTTTCGAGGTGGATGCAGCAGTCAGCTGCAATCTCAGAACGAGACAAGAGATTCCTTTTAC
ACAGAGCCATCCATATGGTATATCATTTGAAGTAATTAGACGACTACAGTGTAAAACAACTTGGAGCTGTTGTCCTCTGTGCCTTGGCCCACAAAGAGTA
GAAGCGGGTGGATGGTGCAATCTCTCGTACCAGAGCCAGCGAAACTGAAGAACGACCTGAAGTTGCGAGCAGAAGGACTGGGCTTTGGAGGTAAGAAGGA
TGGATTATCCTTTCTTTGATGTGACgatactgctgagtcagcaaaTCCGCATGAAGGTTCTATCGTACGGAGAAGTGTAGCTTCTCGAATAAGTGGTGAG
AAAGATGAGTAATTCGTGAATGAAAAGGTCGATGTTGTTCGAAGAATGGCCTTTCTTTACTTTTCCGGCAGATAGTCTTATTGAAGAGAGCTAGAGCTAG
AACAATCATACCGTGGGTTTACTTGCAAGATAGTGAGTAACAAAAATGGTACGGCCGCTTCTTCCAAGGAGGGATAAAGCTCGTCATCTGTCATGAGTGA
TATTTTTTGTGCAAGAATTTGTAAGGCAGTGATGTTACCAAATTGACACGGCATCTTTAAGGAAAAGCAAAGCTCGTCATCATTTATGGATGAGTTTTGT
CATTGAGGACTCTCGCAGGACACTGAGGGCGATGAGTCGGACATTTAGTCTCATGTATTCTATCTGAGTTCTATCTATCCGTTGTGGAAGTAGTATTACG
ACGCGATGAAAAGATGTTCGCAACGTGTGTTACCCATAGATAGGAAATACGTCATGGAAATAGCTATTTTTTCGCGTTATGTAGCAATAGCCGTAGCCGA
CAAAACCGTGTGACGTCTTCAAAAACTCTCTTTCATGCAAAGCATGACGCAAGACTGGTGTCAGAGAGTAAAGCACCCATATCAGCgtcgacgttttgtg
tcagaTAGGCTAACGGCAAATGACGAATCGTGCATGTATATATCAAACTCAATGCAGCCACTATTCCGACAAAAGCTGCATTTCTTGAAAGGATGTGCTG
CAAAACAGCATGGCCGGTTGTATCTTGTTTGGAGCTATGAACCAGGTTGATGGATATCATCAATTGCTTTTCAAAAACAATCAACTTCTTTGCGATGCGC
TGGTTATGCCACAGGGACCGTCAAACGCGCCAGCGACGCTCAATATTCTGGTGATGCAGCTGTTCAAACCTCAACAAGACTGGGTAAAAATAGACTCGTC
CATAATACACAGAGCACGGTTAACTCGATGTGGAGAACCACATTCAATACACGCGACAAGCGCTCAAGTGATGTCATACTGTGGGAATCAAGGCCTAAGG
GCAAATCCCACAAGAATAAATGCTATTGTAGCTTGACCAGCGTCTCTAACTACATAATTTTCAAAAGGTGGCTTGGCCcggccaactacttgcacaaatg
taGCATAAATTATACTGACACAGACAGCACCACCTCTCATCAATCTTTTTTTTGAGACTGTCGAATTGTAATGAGGTGTGGCAGAACAGGCGGCCTTCAA
ACAGTGAAAAAGCCACGGGCAGCCCCATTTTGGCTCGTACAAATCAACATCGGTCAATTCATGTCATTAATGACACTTCAGCCTTTCTGAAAGACTGTGC
TTTATTTCAAGTAGataactgagcgcgtgatcgCGTTCTGCCGGCTTACACTTACTATAAAAATACTTTATTCGTAACTAGAAGTTACTTGCAGCAAGTC
GTACCCTAGTCAGGTTCAAAGTGCACCTGGTTGACCCCAAGCCGTTTTCTTCTGTACAGATCATAACGTCTCCACCAAATCTCTCCCGAAGAATGGCAAC
ATGTGTTTCTTTTGTAACTATATGGGAAGGCATCAATTATGTCATTATAATGTGGGAGCAAATGCGCTTTTGCGTCACCCAGTTTATTGTTTGTTGCTTA
TCATAATAGAATCGTCTCCATTTGACAAGGCGATACGTCCAGGCTGAACGCAACATATGTTGCACTGCTAGGATCTTTGGAAAGGAAGGAGTCTGAGACT
CAGATGATGTTTTATCAAAGCACCCGTTCGCATACCTGCCCCATTCCTTATCCCGTGGTTTGTTTTATTGCAGCACTGA