Description :
From Genome Similarity Track
Location :
Scaffold_27:166177- 181211
Transcript NameFunction/comments
Phyca_LT15348284malate synthase
Phyca_LT1534115142mucin-like protein
Phyca_LT153456780protein kinase
Phyca_LT15348285conserved unknown protein

Sequence
15034 bases(100 bases per row)
cgtgtacacggaggcgtggctgcgcggcagcggctgcatcccgctccacaacaagatggaggacgctgctacggccgagatctcgcgtgcgcaggtttgg
cagtggatccgccacagctgtaagaccgtggagggcaagaccgtgacgaagccgctggtgctggatattctgaaggagtgcgttaacaagcggtctctga
acgccgctccgggcaacaaatggacacttggtggcgagatcatgggcaaggtgctgacgggcgacgacatggtggacttcctcactctgccgtgttaccc
gcgcatcgtgcagcttggctcgagcatctgaagctaaagtcccatcgctgtaaaacgcatcctggtatgccaaggacgagctgactgagcgatccgagca
gttggagtgttgagcggtgggacttcttggtggtggcaagatggaatgataggcctagctggtgtcaacgctgcaggcaagaaggacaataagttgtcgt
tatgatattttataattgaatgcaccacgaattgaaagcatttctcgttgtgttcttcacttgttcgggccgtgcaaaaggtgtacatcgtcagaattca
ctgctactacttgtaaatgaatttgatatggaattgtgttatgaggaacaagttcaggctgctacacgtaatacttcgaagtgtcatttgcctcggtctg
tgatcgaacatgagcttgactaccaccacgttggttccgctgctccttacacatcgctaacaatgccaggttctccaatattcgatgtggtcaggacact
ggggcggttttcggtgtcaggggtgaccttttccttttccgatgaacgtgcatttctgcgcttgaggcttccaaccgttctttttaaaccgagtgcggca
aagcccacaacagcaactacagcaaaagccgctgctccaacagcaatccacaaggtggttccactttcgccaaagattgtcgatttcgagtaggtcgcac
ttgcttcagtcgaaatggcagtatctgcctcagccgagacggtactcatactgcccgcatcagctaagacaatagtggttggcgtagaaatccccgatag
agggtacgccacactggagctgttaattacggcgcagtattccagaaattcagatgtgtttgctggaaagcgcatgcagtaccggcaaccttcatttcca
acacagcctgaagcagtgccttcagggcagttaactgtatccagaaccacgccaatccctccggccgcttggccatcagctagtgacacgtccgcacaga
ttccatccgtccccacgcttgtaaacgcatccgactcacggagcggaactatcacattatctgacgttggctcctgtaccaccgtatcatcggtgatgat
cgccttgaaggtaatgtctgcaccgttgtccgacgaaggaatgtcggaacagctcaggtatccgctcgactgcgccgtatcaaaccgtttgcaaaaacga
cagatgctgtccacacaaccgacacccccgtctccgcatcggagatcggaaaccatatccagaccaacacctttgtctccaccagacactgtcctgtaac
attccaaagggatcgcgtaggcggagttcgaggaagtcgtgggtgaaggtgttggtgaagtcgtcggtggagtcgtcggtgaaggcgtcggggcagacgt
cggggcagaggtcggagcagacgtcggggcagaggtcggagcagacgtcggggctgatgtgggggcgagcgtacttgaagcagaactgctcattgaggcg
cagtccaagaaattggacgactgagcagtggtggtctttcggcaaaaccggcaaatgctgtcaatgcaccccaaacccccttgagcgcaggatgcgtctg
tgacgatgttgatacccaccgccgcgtcacctgcagatactgttgttgtgcagaccttcgtcgtcgtggtttcaggacacgaatttaaatgggcagattg
gggcgtgcttttggttctgcagtagcgacaaatcttgtcgatgcaaccaacgccaccaccggcacaggtcccgtccgttgttatgttgattccaaccgca
acatctccatccgacgctctttgagtgcacgcatttgctgacccaccactcatttaagacgaatacttggggacccagataccagggactagagattcag
gtgagccttgagcgatcgtgggtattctgaatatgacgtcttgcgagtctataggcttcctctacgggaagtagggatgtaacaccttggcttcctttag
catgtttgatcgcatagttctcgtcccaacagcaataaaatagagttgctctaccaaagtgcatcgttcctttgaaacggacacactaacgtcacctacg
cttaaatcaaacacagctgaagaaaaagcaaggagtgattccggatgagaagatgtgaagccacttcaacttgagatcaaaatcaatattgagttgcaaa
taatcccacttgattaatgcactgaacaaattacaacattttcttgatacgtgtcgctgtcatgtgctaaatcatgcccgaagtaagtccgtagttcttc
tttgccgacggtgtcttcggtctcgatgaaatattgcgatgcactgctgtcgcctccgagaaacttttcgaaagatcaatggccaagcctaacggcacga
cattctttgcttcttcgatgaggaaaatgactgtgctgaaggatggtcgctgcgtgggttcagggtcccagcacgccttcatggttctgtgcagaatttc
gggaatgtgcggtaatagctctgggcgaagatcctcatgcgcaacaagatacgccaggttgatggcatctttatcgagataaggctttttgaagcaaaag
agctccctgcacgcagttatcagttagaacaaggtaatcgtcagaaagtagggaataatttgcataccaaagtacaatgccgtaagagtacacgtcaatc
ttctccgaatagtcttcacctcggaaaacttctggtgctaaccatcgtggtgtaccacacatcgtctgcgcgttggcattcttgtcgaggctgcgtgaca
gcccgaaatcgctgagtttacaacgaaagtcttcagtgatcaataaattttctccctgcggaaaagcgtatcaactgtaaaaacatcgtttcatagatag
cttcagtgagttttaccttgatatcgcggtggagcacagctggggtcaatgcgtggaggtaggcacaggctttggcgcagtccagggcaatctcaagggt
aagcccccatgtaatattcaattgttgactgcgtgcgagttgcaaaaggtctgctaatgaccccgcgcatagttcggttaagagacatagagttggtggt
tcgagtacggcaccaaggaacataacgatattaggatgctgcaagatggagagaatagacagctcatttttaaaatcttggacagtctttgccgagtatc
gttgagcaagcagccgcttgagcgcaatgtgctttcccttgaaaaatgccttgtagactaccccgaaggttccagtaccaatttggctctcgatctcaat
gtcttcgaacggaacctttaaaccaaagaaaatcgagttatctagtcgtctggaatctgtgatcgggttcacgcgatgtttcttcttggataaagccacg
taaacgagagtaccagcttgtgttgtcgactggaagtggtgtgttagtggtgacaccgtcaccggtccgcgtgaaaagatgctacccatcggttctacga
gataacacacggctctttcgctaagtgaacgagctgcagaagctaagactcgaggacgcacggcctatttatattttctggaaaatattattatcccaac
tatcaggttctggcacctccctacgtcgttttaaagtcgggatgccgcgcagcagcttgtcaagtgaaggaagtccagcgcttacgatgtttctttagca
gatctgacaactttcatgtagtcaactcgttatcgagttcttatgtttctcttctttacactaagcttaaatttcttcttgtgcggtctttgtttatact
agtacaacattggtacttcgaagtacatgagtagatcagtggaacttccagtgcaggcctcgagcaacactcctagatgaagtcaatggctacatacctt
caagatacgtttcaatgaaactctcgctcagattcaaaggtcggaatctactcaaattcatttctaagcttcccagcactcgtaaacgacgcttatacat
actggaaaggcccagcaaagcgtgtcttggtggtgtttacaccacgataataacaccacgaataattgtgtattattctcggtgcacacacctgctcgac
acgaacgctaagttcagatttgtatttaggtgctacagcggacggacttcgagctttagagtacagtgtacatgtacgtgtaaatgccaaacacactggc
aagctgtattttcgctggtggctagcaatcgaacgacacctcgcttcgcgtggtgatgacgaccaatgggcaacttctttctgaatctccgtttgcaatt
ttggttgtgcagttgacacttggatttactattgctttcgctttgctagaatctccgaatctcgctgccttttctttaccatttgtttttacacacacca
aacctctcaaatttccaaaataagagatcattgtctagattgtcaagagttcctaaagaagcaaaatgtgatgctagcctcttgttctgtcataaaatac
aaaacgcatcaggttttgtacttacaacatttgtaatattcattcgcgagtctagcttttgaatctccgagaaatgggcacattgaagacggaagattgt
gttgacacctcctagaggtagacattagcctcgagccatccagaatcttacccggcactctgcccagcgctcatcacttcccattcgctgcgctccaggg
cattccgctcgatagcttgttatgaaattcggcaaaggcttgctgcaggagatcctgcagagcaacccggaatgggcacccttctggcttaactacaaaa
tactcaagaaacggattaaggctgtgactcgtgcggcacaccacgctgccaaccagcgcgatatatgtacgtgatagaagtatttgctatgccatctttg
tagtgcccccgcttatcatgcagcgtatttctccacgacagctgagtctcaactcgaggtggccttcttccgagacctgcaggctgagctcaagaagatc
tctctcttctatgtagccgaagagaagcgctgctccttccgttatcaccagttgcgctccgttctcaagaatctcaaggtttgccttcctcgtttgccgt
ttgctacattggcaatcagtttaactgttacgtgtacatggctgcagaaacgagagaagattgaggcgtccgaagcgcagagactgatgttcgcatttgt
gcacttctatcgtgagtgcatccgtctagagaacttcgccgtcatgaactatcagggattttccaaggttggcatcaaatgtgttcaagactttactgtt
gacctaccggctaaactttctttcatgattgaaaccagattctgaagaaacacgacaaaatgacgggatacaacacgcggtccaagtacatgcgccgcaa
agtcaacttgtcgactttctcgagctatccagcgctgctgcaaattttgtccagcaccgaagacatgttccacgaagtggagcgcgacgtacgcatggcg
tcagccgtgtccaacatgaaactcgacattgagccacagaagacaaccagctccagtagcgcccatgtgctggccccagtggtccatatcccggcagcag
gagattcgtccacgcccgtgcacacggcgacatcccctcccaagttcccctctccccacctcacgccgtccaactcctccacggtcgcagcttctttccc
ggcttcagtgctttggacaacagaagaccaagcagcggcctgtaaggactcggagcagaaattccagctttagtcggatcccatatatatagtcttaatt
tatctacagaagcagccgtcgcggaccgttttgcttacaaatattgcttacaccaaaaatattgacactacgagcgccatgaaagccaaggctagcccga
cttggtggggtctccaccggagagagcaagcgctgcacttcgtaacgtaagctccccaggcagatgtcagcggagcccgagggcgctgcgccggttgaat
attaaacgggtcttctgcgggcctggtcaggcccctggtcgggcctggaatttattttttattttgctggtctggactcgggtcagactgaccatcccca
aacccgtaaaatatgattgtcgctacgttcctcagttgcgcggcgtttgcaccgccaactccgcttcgctcgtggcgggcagcggattagattgtaactt
aataagaacttacaatttgtaagttcttatttcggaacctactccggcctacgcgccgtcccctgacagacctccgctgcgctccggttgtcatggcgcc
tctctaaggcctcaaagaaatatattgtccgatgtcttggctatggtcctttgtgttatttatcttgtttacacaggtattatattttggggtctgggtc
tgggtcagcccgacccggggcctgaccaggcccgcagaagacccgtttaataatcttcccgctgcgccaatcaggctgaagtgcagccatatccaagtga
agcgagcagccatatccaagtgaagtgagaagcaggtgccaccctaccccaagctaagtcctggtggtggtggtccttgcgctcattctccaacacacca
tggactaccgacaacaacagcaacaacgcgatgcggacatcgcagaaatccagaggatgttccccttcgaagcagttcaaggcaatgcgaatttcttcat
gagaaatccgctgcgagagagacgacggctgaacaagatcgctagaacggcaatgaatcaagagatcttcgtacacagaccgcaagtcaatttacaacaa
agtccagacgacgcagaattgcaaagggacaatctgctctacttggttcggttgggcgcaactcccctccggcgatagcgcgttaaccgatgatggtaat
tttttcccactataaagaagatggtccgagagaggagaattgatgcgagcgtctaccaaggctggtatgctgcaaagtatggattcactactgtgactgt
gaggcgtcgattctctaacttgctctcacatctacgaggaaagcgtttccctatctggagataccccccggtctacgccgtttgcatcctcgggttactc
tccgactctggatttcttcggcgcatggaagcctgtctccgcaatattttcactcggcatatgcggcgccaccaacaacatgcacaaggagaactcctcc
ccggtaacgtgtcatcgtcatcagaaatggttgaattcgtcttcgacgatgaacagcagcgaaaccttcctgttgatgcagaagtttgccattaggcttg
acgctgcccgtttttacgtgcgaggactagtgcgccgtctacgactacgacaacaagaactaatggctatggatatcgacacgcaggaggaactaacgga
cacggaggtcgacatgtataagttgtactttacagttcttgagtcggctgcagcatcgatcgatgtaactttttgaatacaactaattatatgtaccttt
caggctgtacagccagtacatggcaatgccgtccaaatttaaagttagggactggcaaggtcagcttaaacaataagcgccgattggcagaaaatagccc
ctttctctcgcccatgtgcacagctctggcacaccgtcctttctgcggtgcccaaaaatcggtttctccatattaaaagcatgcccaaattttatctgga
cacgttatagcacaacctgcagcactctctcccgtagtcgcacagcgcgtaacactcacggttgtggtaataaagtctgggaggttcgtcgaggttttaa
cggacaatttaacggcagctattgtaaattttgtccagatatattttaaaaacaaaattaacatttcaaaatggcgaatgccacaaactatttgtcaagg
cgcccagctctaataactcagttcccatacagagcgcaagtgaaagtcgtgtcgtcgttaccacagcaggaattcccctgtcgtaaatttcatcagtaga
cactttttgttcacgtattttacgctttttttggctcgcgggcggggtacagaaggggcatgaatccgtaaaatggttgcgtatgatacgctatcttggg
ctgaatagcgtatcgaacgaaaccagttaaagctgataaaacgtaatattttataatcctgtttgtattcagaataggaggtggtatcaacaacaaacgt
gagtttaatgtataccacacaactgtaccgcactgcaaattccgcactcatcgcctctagaatggacgacgagcagctcgtcggtaaagccacggagtta
caccacaacgaagctacgtcctatgcatggggctgtacggttcctcttcacacgactacagctacagagaagcatataggcgtttgcagcgagcagtatg
tgatagaatccaccttcggttttgacgttgatgatttgaacataacgtctactgtgtaaacagcgtttccgcctgccagatcaatagctgtcggccaccc
gagggcagctttatggcattgcttttgagcactagtctagctagtgggagtggtactgcagtcggtgatgatggtggaggtggtgtcgccgcctaccgtg
tagatgataatggcggtggtgtcgctactggtggcgccgtctttgatggtggtgttgtcgttgccagtggtgacagtgacagtggtgttgagtatggtgg
tgacggtgacagtggcggtgccgccgattccggtggcagtgttgacaatgacagtggccgtgatttgtctgagagcgattctgagtcctttatcaatgac
tacgaggaggccctggttgaggcagctgagaaaatgcttcgtcaaacccccaaaaacagcgttgacttactgataattcaccgaagacgggcacgttatc
gtcgcttgagactgcttagtcgtgtcgttgcgtgcacactcgcgattgagaggagaacacaagaaaaggaaacccttcgcacacacgttccaagtgttcg
cttcaacattaactctttgtctgacaaggagtgtctggataggtttcgatttcgaaaagttcaccttggaatattactttggaagtttcaattaccggca
tttttttcgacattggaggggtaccggtcttctgccattgaaggcctctgtatttctctcgagcgtctgagttatccgtcacgctggtttgatctacgaa
tcaaatacggccgatctgaaagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn