Description :
From Genome Similarity Track
Location :
Scaffold_412:16616- 22019
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_412-snap-gene-0.9Nuclear distribution protein nudF
Pytul_var.sporangiiferummaker-pug3_contig_412-snap-gene-0.14Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_412-snap-gene-0.10Conserved gene of unknown function

Sequence
5403 bases(100 bases per row)
GAAAACTATGAACACGCGCTTCTCTGTTTCGAAGCTACAGGGGACAAAAAGGGACAATTGTTGTGCTTCCGAGGGCTCGAACAAGTACACGGTAAACTTG
AGGACACTGAAATGGTCCAAGTGAACAAAGAGCTAGCCGATGAGATTGAGTTCGCACTCGCCACCAAACTCTCGAATGCCGGTCAAGTGCTGGATCATTT
GCGAATGCGACTCGTCGGTGCTGGTGCTGAATCGTTTACTGAGATCATGTTGGAGCGAGTCGGTGCAATTGTTCCACGATTGAGGACGCAGCGCATCATG
CGCAAACTAGACATTCACGAAGAGGCAAAGCTCGTCACAAGCCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGCGCTGCTAGCC
CAAGGAGAAGCCGATTTGAAGCGTGCACTTGCAAGTGATACGCCGCTGGTGGACTCTAGTGCGATCATTGGTACGAACGTTCGGTACGAAATTGAAGATT
TCAAAAAGAAGCTGGCAAAGCTCATGGGAAGTGTGAAAGCTGGCGAAGACCACATCACGAAGGAAATCGCAAATGCCAAAATTCGAATCAGCAACTCAGA
AGATGAAATCAAAGAGTTAGAAGCAGAGTTGGGTGTGGAAACGGGTAACCTGATGCGGCAGATGATGTCGAAAGACAAACTGCGGTGCTTTCGTTTCAGT
GCCACGAACGAGGCACTGAAGACTGTCATCGGCACTGCGAGTCACGGTGTTCCGACATGTGTGGCGACGGCTGAGCTGACTGGAATCCTATTTGATTTGC
TCACTGGGGCGTGTCTAGGCCAGGCGGTGGGGGATCCGCACCGACAGCATTTGGGTCCACCGAGGGGTCATGAAGCTCAGATCGTGAGTCTATACTACAT
TGGCAATCGCATCTACACTGGCGGCATGGATACTGCGCTCGGCATTTGGGAAGTTCAGGATGCCGTCATCGGGGGATTTTCCGTGACGTTGGTGACAATG
CTTCAAGAGTTTGATGCCTCTGTGGTCAGCGTCGTCGCAGACATGCAGCTAATCGTGTGTGGGTGCTCAGATTGCGATGTGTTTGTCTTCGATGCAGTCA
CCTTTGCGATCGTCGCGCGCATGATCACTGCGCATGAGCGAAGTGTGATGGGGATTGCAGTCGACAGTGGCAACAACTGGTTTACCACGGCTGGCGCTGA
CAATCGCGTCAAAGTATGGGAACTTGGACCTCGCTCAACGCAGACTTCGTACCGGAAGATCACATTGCGGTATTGTCTCGAGCCTGAGCGTCGTGGCGAT
GAGTTTTTCAACGGCCACCTGCATCCGATTACGTGCATTAAGCAAACGTCGAGCGAGATCGTGAGTGGTGACAGCAACGGACGCATCATCATCTGGAACG
TTGATGCCGACCGCAAATTGCTGCGCATCTGTGACGTGCACAAAGGTGGCATCCCCGTGACGTGTCTCCAATTTGACGCGACGCGAGTTGTGAGTGGCGG
TCAGGACGGTACGATCTGTGTGACCGATTTTGCCACGGGTCACCTACTTCAGACGCTTGTGGGTCACAAGGAGAGCATCTTGGATCTCCAGTTCGATCGT
AAACGGCTCATGAGTATGTCGAGTGACGGGAAACTACGTTTGTGGTACTGGCAAAGTCGCATCGGAGTCGGTGGAGACCGCAAGAAGTATCACATCCTTG
GCTCCGGCGAGACACTCAAGGCACTTTCGCTCAAGTACCACACGAGTATCAACCAATTGCTCCAGTGGAACGGCCTCCCCGACTCGAGCCACCTGTATCT
GGGTCAGAAGTTGATCGTTGAAATTGATACCAGTAATAGCGCTGCCGCCGATGAGCTCAAGACTCTGGACATGGCCATGTCCACGCAATTTGGCAAATTG
TCGTACGAAAACCTGGTATTCATGGCTGCCAACAAGGTGAAACGAGCCGATGTGGAAACTCAATGGGGGTCGCAGAAGCTGGCGATGCTCGCCAAGGAGT
ATTTTCCGTCACTCGATGAAGACGAGGAGGGAAAGAAAGAAGAGATGACGCAGGAAGACGAAGGCGAGAGCTCGGATTCCGATATGGCGCTAGAGTCCGA
AGAGGAAGGGAGAGGTGGAGACGAAGAAGCAGAAGAGGAAAACGATGGGAAAGCCAAGCAAGACGACTGATGCTACACACTGCCGAAACAGAACAGCAAA
CACCAACGGAACAACGAAAAGTCCAACATCAATATGTTTTTGCTTTTTTGCGAAGAGAAGGAAAGAAAGACATGACACAAAACACTCAACCACAATTCTC
AATTTCTTGGAAACCAAAGAAAGATGCAAGGAGGGCAGGAATTTACACAACACGGCCGCTATCGTCCTCTGTGGACCAGACCGACTTGTCTTCCAAGTAC
ATGTTGCAGCTACGGAACGCCGTGCGCGCATGGTCGCCCGCAAAGAATTCCCACGCCGTGTAGAACCAGAACGCGACGCACTTGCGGTAATCATTTGGCT
GCACCGATCGCTTCAACGACAGGATCTTTCGCCATTCCTCGATCACAAACGTGGACAAGATGTCTTCATAGTGCGATAGACGCAACGGGTTGCGCACCGT
GTAGAACGTCGTCCAGTACTTGCCGTAACCTTCAAGTTGCTTCAGACCGTCGTTGAACTCCGGGGAGCGGAACTCTTCGAGTGTCGCATCGAGCATGAAC
ACGAACTTGTCACTGTACTTGGCCTCTTCGTCGTAGAACTTCTTCCAGGTCACTGAGAAGAACTGCAGCGCTTCGTTCGGGTCGTTGCGCTTGACACGGT
GCATGCTGTGCGCGTGGCGAAGCTTCACAGGCTTCTTGCGCTCCCAGTGCCACTCCTCAGTCGGTGGGAAGATCGCCATGGGCACCATCACGGAGCCGTT
TCCGCAGATCGCGACGTACACCGAGATGTAGTCATCGATCTCCGACGGTTTCGCGCCCTCGGGGTTCTCCTTTGGCGGCGCATCTTCGCCAGCTTCTACC
GTTGGGTCCGGCTTGTGAAAATCTAATCTAGTCACAAAGTACATGAACTTTGTTGGGAACGGCTTTTGGTCAAAGAACTCGCGCAACTGCTCGCGCAGCG
TGGTCATGTCCTTCTGGTACACCTCCTTCACCTCAGGTGTCGTGTAGTAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCATGGGTCGCC
GTCGGGTCCACCGTCGATGGGAATCCAAATGGATCTAGCACACATGAGGTACATACACCACGCACAAGTGAACACCCAAGCATTTTGCATCCAGAAGAAG
AAACAAACAAAACAAAAAAATGTCGAGTATGACGTACTGATGCCGTCGCGGCCGACGTCCTTCTGCGTGATGCGCAGCGCGTGCTTGACCTCGTCGAAGC
TCGTGTGGTTGGAGCAGAACTTGTTGTAGCCGACCCAGTACTGCGCGTACGTCTCGTTGAACACGAGATGGCCGCGCTGGATCGTGGACGCGCACACGAG
GCGGTTCGGATCCGTGGCGCGCAGGCGGTCGATGTTCTTCTTCCAGTCGCGGATCTGGCCGGTTTTGACGCCGTACTTCTGCGCCGTCACGGCGATGAGC
CCCGTGCGGTCGGCCTCCTCGATGATCTCGAGCTTCTTGCCGACCGTGAGCCCACGGTCCGCCTTGCCGCGCGCCATGTTATCAGATGCGCGTTGATTAG
ATTAGGCAGAGGCCACTGTAGCTCTCGCTTCTTCGATGCACTTGGTAGTGTGGCGCGGCAACGCGCGAAGTACTGTGAGCGGCTCCAGCGAGTTCTCGTA
TAATGGCCCCTTTGCGGCGCGAAAGTTGTTGCGGGAGAATGAGGTTTTATGATGAGGTTTTTTCAAATAGACGAGAAAAGCATGTTTGTTTTTGTATTTT
TGCGCGGGAAACATTGCAGCCAATCACAAGACGGGTAGTGCTTCCATTATGTCCAATCAATCCATTCTACGTATTGAACAAAGTATTTTTTCGAAAAGAG
AACATGAAGAACAAAGGGCTGGGTGAACAGCAAAAGCCTGCACAAAAACAAAGTACCTTTCATAATATAAAAGTACTTTGTTTGTTTAATCGTACCTACA
CGAGAACCGGCAAGAGGAGTGGGTGAGTGAGTGTGGTGCTGTGGTTTGACTTTCTGACTGACTGCCCAAGAGCAACAACGTGCGTCCGAGTGGGAGGAAG
GAAAGGAGCCNNNNNNNNNNNNNNNNNNNNNNNNGGTTCTGCGTGAGGAAGCGCACGACGATGGCGGACCAGAAGACGCGCAAGCGCACGGCACCGGCTT
CCCCGCGGTCACTGCTGCGATCAGCGCCGCTGCTGAGCTCGCCGTGGCTCAGCCACGAGCTTTTTCCGGCGACCAAGAGAGTCGCGAGCGCGCCCGACGG
CCTCGCAGTCGCCAAGAAGAGCGCGGTCGCGAAGGTGCTGCAGGAGCTGAAAAAGGGAAGAAAATACGTTGACAACCAGCTCTTGCACCTGGAGGCGCAG
CTCGTGAATGTGAGCGATTTCCTCGCCAATAGCGCCTCGACGAAGCTGTTCACTGACTATGGACTTCCCGACGGACAAGTGTACGCGACAGAGAATGGCG
CTGCTGGAGAAACTACAATAGGGAATCAGATGATGGACGGCGAGGAAGTCCCAACGTCGCCCAACTCAGCTGGACTCCGCAGCAAATTCGTGCAGCACAA
CTTTCCTGTAACTGCGACAACAACGAGCTCTACAGCTAACCCACTGAACCCTGCGGAAACGGTTGAAGACGACTTGGCGTCCGGTACGTCGCTGTTTGTG
CTGATATTTGCAAAAAGCATATGCTTACGATGGTGGTGCTTGGTTAATCATGGCTCGGCTTTTCGCTATACTGCAGACACGCCATGTACGACAATTGGGC
TGTGGAAGTACTTGAGTGCCTACGAGATTTTCAGAAACGTGACGCTCGAAGATGTCGAAGTAGCATTGCAACTAGAAGGTACAGGCTGCGTCCAATGTTC
AACGCATTGGTGTATCTGTGGGTGAATGGTGCTAACGTTTTTGTATGGCATGCAGAACCGAATCCGTTAGAGAACGATAGAGACCAGGAGCTTGCAACCG
TTTTCCATGAGCTCGGCGATACGAAAGACACGGTGGAGAAAGAAGATGTGTCAAGTGGCTCGCCCATGGACGAATTTTTGAAAGCGGTGCGCCATAACTA
TACATGCGAAGCTACCAACAAGCACTCTTCTGATTCAAAACATTGTGTGTTTCTTTGTGTATGCAGAGGCTTGTTGCTGCTATTGTACCGATACCAAAGC
AGCATGTTCGTGCAATTGAGAAATCATTCATTGAAGAAAAAGCGGAAGGTAAACAGGAAGTAGAAGGCGACTCGAATGGACGTTGTATAAACGAAGAGGA
TGC