Description :
From Genome Similarity Track
Location :
Scaffold_236:16616- 17645
Sequence
1029 bases(100 bases per row)
TGATGCTGGTGCAGCATCCACGACATCTTTACCGCGAGTGTCGCTGTCACCTGCAACCACGGCCGCTTGTTTTTACGAGAGAAGAGTTGTTAGCACACCA
TCGCAACTCGCTGCGATGGCTGCAGCTTCAACATTTACATCAATCATTGATATACGACCATCTGGCGCGTCATCGTATAACCCAATGCCCGTCATCGATT
TAATTGCAGCTCTGGCAGGGATCGCACTCCAAATGCAGTAGCGAGAGCAGGAACAGCTGCATCGGCAACGCGAGACAAAATACCCGAGTCGTTAGCAATC
TTGAAAGCTGATTTAATGCCTCCCTAAACCTTTCCCCAAGTACTCGCTCCATGCATACCACCACCTTGCATATGCTTGAACGGATAGCCGATCTCCTTCT
TAGTAATCAGAAGACGCGTTCCCTTACCAGCTTTATGGACTCTGAGAGCTTTTGCGTACGATTCAGGGTGAAGATGAAGCGTAGCGCCAGACCCACTTAG
CTCATCTTTGGTCAGTGATAGTGTACCGATCTTGAAAGATCGCTTGAGCTTTGACTCAGGAACATCACTGGCGATAGCTAATTCACGGTACATTGTAATA
ACCTATATTTGTTAAGCTAAATAATTTCTATTATAGAATAGTCAAATTGAGGTCTTTCATCTTGTCAAATACCTGTGGCTTCTTGTGTTGCTTGGAATAT
AACCAGAGCATACACCATATTCCGCAGTAGTCCCCATATGTACCTTGATACTGCTTGGTATTGTATTTGCTAATGCCATACTTGGTTGGAGGACCTTCTC
CCATTGAATCGTAATATTTCCCGTTACGGACTGCTGTCCAATGCCCTACATCCAGATTTGGCGTTCTTAGTGGAATCAGATACGAACCTTTCTTAGGTAG
TGGCTTCTTAATTTCATTCGATTCAAAAATGTCATCCAAATGTACTTGTAATCTATTCGCGAGCTGGATGACCGGCGTTCCTAACCAGGCTTAGGAACTA
TCAGACCTCTAGTTGTCAATAAGACCAAA