Description :
From Genome Similarity Track
Location :
Scaffold_4:1661595- 1667033
Transcript NameFunction/comments
Phyin_T30-4PITG_03419Flagellar protein%2C putative
Phyin_T30-4PITG_0342050S ribosomal protein L13

Sequence
5438 bases(100 bases per row)
CGCTACGATGGCGGAGCTGCTGCTACGCTGGCTCAACCACGAGCTGGAGCTGTCTTCTCGTGTGACGGACGTGGAGTCGGACTTTTCCAGCGGCTACTTG
CTTGGAGAGATCCTGCACCGTCTCAACCACCAGCACAACTTCGCCGACTTCATGCGAAGCTCCAGCGCCGACGCCAAAGTCGTTAACTTCTGCTTGCTGG
AGCCGGCGCTGCACAAACTTAACGTTAAGTTTGACGCCAATGTGGCCGTCGCTATCATGAACGAGAAGAAAGATGCCGCCGCCAACCTGCTCTACCAAAT
CAAGATGGCCGCAGCCCGAGTCGGGAGAGCTCCAAATGTTTCGACCAAATCGCTGGAGCGGACTGGTATCATTCCTTTGCACAACAGACCCGTGAAACTT
GCGAAGCCAATCTACGACTCAGAAAAGCACAAGCTGTTTGAGCACTCGATTCGTCGCCATGTGCGGTCGAGCACTTCGTTGCAGCAAGAAAAGTGGGTGC
GCGTTATGCTTGGAAGCAGTGTTCCTCGGTTGTTTGACCGTAATCATTTCTGTTGTAGGGACCAAATTGCGAACGAGACGAAGAAACGAGAGGCTTATCT
GGCGAGCATGGCGGAGCAGAGAGAGATCCTGGACAATACAAAAGCAGAGAGACTGCACCGCGCATACATCCATAGCAGCTATATTAAAGAAGCTTTCGAA
GAGACTGATTCGCCGGCATGGAGACTGGCACTGCAGAAAAAGAATGCATGCGAGCAGCGACGGGTTGCATTCTTACAGCAGCTGATGAAGAAGCGCGAAG
AAGCGGATGTATGTTTCGTGCATTATACCTTTTGTGCATTTTCTCGCTAACAGCTGACACGGATACACTACAGGAGAATCTTACCTTCAGTCTTCGTCGT
AAAGTTTGCAATGAGCTAGATGATTTCGATGTACGTTATTAAGGTATTGACGTGTTTGCCTTTGCTTACAAAACGCATTTCTCACAGACACAAGATCGAT
CAAAGGCTGGAATGGCGGGCAGCAAGGTTTCTTCACGGAAATCGGTTGGATATGGTCTACGCTCACTTACAACAGCACTGAATGTATCGTCCGACAAGCA
GAAGTATTCAAATGCTCACTTGGCGGGATCAGCGATGAACGAAGCGGAGCTTTATCAAGCAAACATGTTGGAAATGGAAGACGCATCGGGCGTCATCAAG
CAACAAAGGGCTCTACGTGGAAGACGCAAGGACAAATTGTCTCGCAGAAGGAAGCGGTTTGTTCAAGATTGCGTGAATACGCACTCTCTAATAGGAACCG
CTCGTGTGGCGAGTATTTTGGAAAATCTGGTGCTGCGTGACACCAACAGCGAGAACGATATACAGCATGAAATGGACCGCATTCTCGTGTACAAAGAAAT
AGCTCGGGAGAACAGGTCAATGCGAAACCAAGAGTATTCGAATCAGCAGGAGGTGGACTCCATGACAGCGATGGATCGAGATACTAGCTGCTACCACAAT
CTGCTTCTTCAATTCGAGGATAACAGCGAGATGCAAATTTTACAACGAAATGACGTCCAGCAGTCCATTGAAGCAGCAGAACGCTTTCTTAGTGAGCAAA
TTTCGAGCACTATCATGCAGGAAATGGTGGCTTTTGTGTTGTTCATAGCTGGGAAAAGGGAAGAAACGTTGCATTCTAGAGATCCTGCCGTATTCCTGAC
GACGGAGACATGGAACGAATACAAAATTAAGTTTGCGAATGGATGTAACTTTGAAGAAATGACTTCGTGGTCTGCGTCTGTAAAGCCAAGTCAAGCAGAG
TTACTGGATATCCAGGAGCTGGAGCAATATCTGTCGAGTTTCCTGCCATTCCACACCAAACTGGATCAGGAGGCGCCACTGTCGATAATCAATGATGGTT
TTCTATTTCCAGGAGCGACGGAAGCTATACAGGATTGCTTCGTTCTTGGAGAAGAAATTAAGACGTTGCGGTGGATTTCTCGCTCGTTGCCTTTAGTGGA
GAGCCATGAGCTTGACGAAACCAATGTTGCGCCGTGCTTACCTGGCTCCAACGGACCTGTAACGAGATCTCATCAACAACTTCGAATCCTTATCTTTGGC
CCTGCTTTTTCCGGGAAGGAGACGCAAGCGAGGCTTCTTGGCGAATCACATAACTTGACTGTGTTGTCTGTCCATGATCTCATTCAATGCTCTGTTAAAA
ACTCAAGTGGAACTGGAGTCGAAGTAAACGATCTTCTTGTCAACGGCGAGCAAATTCCTCTGGAGCTGTACAGCCGCCTTATACTCGAAGCGATCAGGGG
GATAGAGCAATCTTTTTCACTACATGTAGATGGCAAGAGTAAAGCCGGCTGGGTGATCTACGATCTGCCTGCAACAGCACAACATGGCCAGAGTTTAGAG
GAGCACCTCACAGGATATAAAGACCCAGCTGATACTTCTTCTCCGTATGATTTCGAATCCTCCATCGCTCCAGGTCGCAGCAAGCCACCGTTGACTCCGA
CATTTCTACACGGTAAGTCGGGAGTAGATCTGGTCTTCCATTTCGACTGTCCTGCTGGAACAGTCTTGGATCGGTGTTTGGGTAGAGTGGAGGATGTCAC
GACAGGAGACACACGTCATTTGGTGTTCGACCCACCATCGGATGATTCAACTGAACGGCATCGACTGCAGCACGTCAATTCTAGCGCGTATTCCAGTGAG
CTGTTATCTCTTCACTGTTGGGCGAGCGATGAATTTATGCACGACCACAAGGCTTGGTACACGAAGTTTAATACTCTTGATGAGCCTTCAAAGACTGGGA
TGACTGCAGACGAAGTACATGGAGCTGTCACGAGTGTTGTGGACCGTTTACTGAAGGAAAGAAAATATGAAGCGGAGTCTAAGCAACTCCAGCAAGAGGC
AGGCGAGCAAGCTCTTATGTCAACTGAGGAGGAACGGCAACGACGTATGGATGCGTTTGAATCGGAACTTGACGAAGCCAAGATAACTGTGATCAAAGTG
GAGGCGTCCATAGCAGAGGTGGAGGAAGCGAAGGCAAAGAAAGAAGAGACGGCGGAGCTTCGGCAGAAGTTGGAGGGAGCCCACCGTCAACTCGATGGTA
TTAAGACTGCTGTAAAGAGCTGGATGGAAGACGAGATATCGAGTCGTCCTGTGCCAAGCAACAAGTATTCGGGAGAGCTGGTACCAGCAACTGCCCAAGC
GCTCGCAGCATTGTGGGATGAAATGGAAACAGAGTACATTTCTACCATGAAGGAAACTTTCGCACAGCTACGTGAACAGCGACACCGTGTCACCGATCGC
GCGCAACAAATGACGAGCGAGTATTGTGAGTTCGTCCGTCGTTCCGACCGGAAGCAAGAAGTTGTTAATCAATTCCAACGGCAATTCAACGAGGTGGTTG
ACGAGATGCGTTTCGAAGATCCGACAAAGGTGGAGCTTCACTCCCGTGCAGATATCCTTCAAGATGAACTAGGATCTCTACTCGAGACTAAAGCCTCAGA
AAACGACGAAGAGCTCAATAGCATGGTTGGTGACGGGTGGACTGAAGACACATGTCAACAGGTCGCTGCGATTTATCAAATGGCGCTCCAGGCCGAGTGG
GATCGCTTTCGGACGTCTGTTCAAGTTCTCGTTAACGGCCATTACGCTGCAAGTAGCGATTGCTCGGCGTTGAGTGGAATTATGGAGGTTTGGCAGTCTC
ATCAAGCGCGACTAGAGCAGGCGTGCAGAGTTTATCGCGACCCAGCGAATATAACTCCGGTTGAAACTCCGTTAGTGTCCGTCGCAGCAGCGAAAGCTGC
TCCGAAGGGGAAAGCGAAGGCACCTGCTGCTGCCATCGTGGCCCCATCCAATGTGGCTGCAACGAATGAAGATGCACTGGCAGAGGCTTTGACTATGACT
GAGCTGTTGGCGGAGTATGGACACGTTCTTCAGCGCTGTAGCTCGTGGATGGAAGCTATCGCTCTAATTGCCAACCCTGCAGCAGAAAAGGGTGGAGAAG
CTGGCGACACGCAGAAGAAAGACGGCGATTGTTGCAAAGTGAATTTGCTGACTGGGATCAAGTACGAACATGATCTGATGGAGCGAAGAGTTCGGTTTCT
TCGGGAATCTACACAGAACTCTAGCGATGGAATTACGAGATCAATGCGCTCCATAGAGATCACTTTACGAGATTTTTCAGAGGATCGGAGAGTTCGAGAG
CAAGCGGCTGTGGCTGCAGTGATCGAGTATATCCGTGTCGCCGTGGAGAATGAAGTCGCTCTTTCTTCTTTTATTGATGTCAGCGTACGTGTTCTCGTTA
TCATGTTGAGATTGCTGCACCGTGCACGTAGGTTAATTTGTTTGTTCTTGATGTACTTGCAGCCTGAATTCGTCGAGCGGTTCCCAGCGACTGTGCAGCT
GCGTCAAGATACGCTGGTACGAGTTGATGAAGGTAAACGATTGTTGCCTCAAGCTCCTCCAGATACTTCACCTCTTGTTGAAGAATCACACGAGCTGCTT
CTCAACCCTCGTCAACGCGATAGTCTTCAAGAGGCTTTAGCCTCTCAGACCACCGACGACTCTGGACTTGTTCCTCTCATCACCGTAGTGGAGACAATGA
CAGCTTTGACATCTTTACCCGATGCGCTTCCTGACGTTTGGCGACTGTGCCCTGCACACATTATTGCAGAGGTAATAGCCGCAATGCTCGCACTTTACCT
AGAGCGGTCCTTAACTCATGGCTCCTGCTCGTTTCCCATGACAGATCGCTGCAAAATTCACAATGAAACGCGCAGGGTTCGTCGATATTGAAGCTCTGCT
CACTGCCATGAGCACCCGCGACGACCTGCTTTGTCAGCTCCAACAAGAAGAACAACTCAAACTACAGGAGCAACAGCCTATGTTTGAACAACAGCAAGAG
ACCTCAGATAATGAGCCTGTGTCCACAGAATCAGCGGCATAACACCAACCAAGCAGCACAATACAGTCGTGTATTCTTCCCTCACCACCTTTTCGTCTGT
CTCTATAGCTTAGTGGATGATAGGGTTCTCGCCCACTTCCGCGACAAAGTCGTGTTCATCGCCCATGAAAATCTTGAGCTTCTTGTCTTGCAGGGCGCGC
ATGCGGTTGCGCGGCAGCATACCGTACACGGCCTTGCGCAGCACCTCCTCGGGCTTGCGATCGAACATCTCCTTGGCCGTACGTTGCTTGAGACCGCCCG
GGTGACCTGTGTGCCAGCGATATAACTTATTGTTCCACTTGTTGCCCGTGAGCACAATGTCCTTTGCGTTAATCACCACCACGTAGTCACCGCAGTCGAC
GTTGGGGGCGTACGTGGGTTTGTGCTTGCCGCGCAGAATGGGCGCCAGCTGCGACGCCAGACGACCCAGTACCTGGCCCTTAGCGTCCACTACGTGCCAC
GCCACCTTGGAGGCCTGCGCGATCTTGCTCATGCTTCT