Description :
From Genome Similarity Track
Location :
Scaffold_28:166116- 168070
Transcript NameFunction/comments
Aphas_H257_10412AlNc14C85G5459
Aphas_H257_10413PREDICTED: protein Mis18-alpha isoform 1

Sequence
1954 bases(100 bases per row)
GGAAGTAAGGTCGCTTTGACTCGACTTCATTGAGTGTTTGGGGGAAACTACGGCGGCATCCCGAGAATTTTCGATGGCGTCGCCGTTGTCGTGACTGACC
TCATGTCCATGATGCTTTGGTGGCGGGGTTGATCCTGGCGGCATCTTGCTTCACGGTGTCAACAGCGCCACAGCGTTGGAAATCTGTGCGACGAGGGGAA
TTCAAAAATGAGAATTCTGGGAATTACTCTTGCATATTGTATATCAGCCTTAGTTGACTTGGATTCAGTATGTGTTGAGTCTGGTAAAGGGCTCTGATCC
CATCGAGTGAATTTAACTGGTTGACTGTTTTTCACTATTTACGACCAATTTTGGGTCTACTTTCCTTGAGTCGTCAAGGGTTAGAGGCTGAGGCCTCACC
TTCTTTTGTTAACATTTCAGTGTGGACCAGATAACTCAATTACCCGGTATTTTGGAATCTGCTGCGGATTCCCAACTGCCTTGGGGTAAACCGAACACCA
TTAAAGTATCTGGTGATTTGTATGTGTCACCATCATTTTAATATAACGTAGAAGTGATTTCGCCGCATCAGATGATTTGTTTGCCCTGGATTTGGAATCA
CTTGCAATTTGTATTGCAAAAACAGTTTGAGACATCTGATGCCGTCCCAGGTCTCTGATCCGACGGGACCTTCCAGTATCTCATCCCACGAATCGAAACC
TTTTGAAGGTGACTTCAAACCCACATGCCCGCCCTAATAACGTACATTACTCCCCCACTGCAAGCGTGACCAGTCTAATCTCCCAAAACTCGCACTACCG
TCCACTCCTTCCCGCTTTGACGGCACCGATTTTGCACAACAATCACGCACGTCAGTGGAGTGGCAACTCCTGATCCTCAACTTCTCCCCCGAACTATACC
ACTTTGGCAACCATTCACCCACGTGTAATGTCGCCATGTCCCACTACCCAACCACTTGCCAAGAGCCCTTGTCCAGCCAACCCGCAAAGGCTCTGGCGCC
AGATCGACAGCTTTCTGTAAGACTACATATAACTGTGAGATGTACGTACTTGTTGTCGATAAAAACAGGCAAAATGGCCGGCCCATGCGACGACAGCATG
ATTGCAATAGACGAGACCCTATCGTCACAGACGACCTAAGGACTGTACAGTAACACGTCCTGTCTGAATGCTGACTGTACTTCCTCTTTGTTCAAGTCCA
CATCGCAATCGACTTCGAAATTTACCCATAACGTTAACGTAAGCTATTTTTTGCCCAAGAAAGCCTCGCATACTTAGGAACTTGCTCGCCAGTCAAACTT
GAAAACCCGTTGCCTCTATAATTTAATAATACAGACGTTCGTCCATTTTGACAGGAAACCGCAGAATGGGGCAAATCGTGTGGGGCAAACTAGTATATTG
GGCCAAACGTGGCACAAGAATTCAAAAAGCCAAACCTGACGCGGGGATGGCCGACGACGATGTGGTGGAGGTGCCGTTCCCAGTGGTGTTTCAATGCCGC
GTCTGCCGAGCCATCGTGGCGGACTCGACCTCTCTCTCCTCTAGCGACGTGAACCAGCGAACGATCACATTCTGCCGCGTGACGCATTTGCAGCCAAGCA
CGGCGATCACTGCAGAAGGCGGGAATTCGTTCCACACACTGCTATGTACTCAATGCGACGGCGTCCTTGGCAAATTGTACGTAGGAACTGTTCGTGCCTT
GGACCATGCTCGCGACCTCTACACGTTGGACGCAGGAGCCCTCACGAATTACCGGATTGGCACATCCATTGAAGACAATTTAACCACCACAGGCCAAAGC
GACATTCTCATTGCAGACGACCCAGCAGCTGATCCTACGTTGACAGTAGAGCAGTTTCGCTCTGACATGGACAAGGCAAGTTATCACCCTCGCTGATGTA
ACATCATCTCAATGGGTGGTGTACAGGTCCAAAACTTCCTCCTCTTGGTCGACG