Description :
From Genome Similarity Track
Location :
Scaffold_275:16610- 18096
Transcript NameFunction/comments
Phyag_g4201hypothetical protein PHYSODRAFT_560159

Sequence
1486 bases(100 bases per row)
CGGCGTCGGAGCCATTGTCGATTGAGAAGGAGTTCGAGATGCAAAAGTCGTGGAGAGAAGACGCCGAGAGTGAGAATGCAAGCAATGGCTGTGCTGAGAG
TTGAACGTGGCGATTTATTGTATTTCTCTGTGCTTTTTTTGTTTTATTATTTTAGAGTGCACTTTCATCGTGTTGGCGAACGCTGAAGGGGACGGCAAAC
CAGGATTTTCGTACGTCGACGAGAGCGCGATTGACCGTGAGTTTGTGACGACACTGttggagttggtgcagtCGATATGAAGCTGATTCTTTCATTTGAT
GGGGCGGTGAACAGGTATGGCGGGGGACGTGAACTTGTTCTTCAACGACTATGACGACCCGCACGCGtgcgagatggagatcatgattgcggaggagaag
caccGTCGCAAGGGCTTCGCACAGGAGGCAGTGAAGCTCATGATGGCTTACGGTAAAGCAACGGTCTGGGTATTTTTCGTAGGATATTGGATTTATAACT
AAGTGCGTGTGTGTATGTTTTTCGTGATTTGAAGCTACGTCGAAGCTGAACGTCACCCGATTCATTTGCAAGATCATCGAGACGAATGGTGCTTCGCTTC
AGCTCTTCGAAAAGTAAGTGGTTTGCCATGGTTTTGATGGTTTCTTTTAGTGGTCTAACCTGGTGTCAAAATGCAGGCTGGGGTATGTGAAGTATAACTA
CGTGGCCGCATTCAACCAGATAGAAATGGAGCTGGTAACCAAGGACAAGCACGCAGAGCTTGTTGATGCTGTGCTCAAGTCTGCTGTCATCCACTCACCA
CAATAAATGTGGTATCAAGATATTTCTTGCAGAGATTGACCACGAAAGTctcaacttcttcactttTGCAATAAAACTTTTCCATGCTATGTTTACAGCT
AACCGACGAGTCCGCTGCTTCACTTGTCGGATTCACAAGACAAGATGAAGCCGCAGccctcatcttcttctcagGGCTCAAGGCGAGCGAGTCGAGTCGA
CACAAAGACAGTTTACCTTCCAGCTGAGGTATTCGAGCTGTTCTGGCATACCAAGAGTAATGGTTGACTAACACGTTTTTCACCGTAGATTCCGAATGCC
TTACAAAAAGGTTATCGTCGGTTCGAATCACCTCGGCCTGCTCCACAGCGCGCAAGGCCGAAGAGCTTTTGGATAAAGCGCTTCCCATGCCAAACGCTGT
TGAGAAAACAGGTTTGACCAGAAAAATGTTGAATACCCCGGAATCAATTACACTGGATGCGTTTTTGAAGAAAGTTCAAAGTGGGCTAAAGCTGATGCAA
CGATTGGCCACGATAGACCAACAAATCAGTGACCCCGACGCAGTTACAATTGATGTCCacgacaagatgcagcacttggtGACAGTCTCGCCAGTTAATG
GCACATTTTGCGTGTGGAGGCTGCAAAGCGGTACTGTGGTTGCTACTGGCACTGTTACCAGAAACCAGTTTAGAAACGAAGATTCT