Description :
From Genome Similarity Track
Location :
Scaffold_178:16606- 21479
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_178-snap-gene-0.28Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_178-snap-gene-0.16Dihydropteridine reductase
Pytir_DAOMBR486maker-pir_contig_178-fgenesh-gene-0.12Transportin 3, partial

Sequence
4873 bases(100 bases per row)
CTGCAGACTTCATCATTCTGACTCTTCCTGTTGGAACTGCTTCTTGGCTGTCTTGGTGGATTCTCCATGATCATATCATGGATTGTCATTTCGATTTTGG
CGGGTTGTCCATCGTGGATAAATAGGGTGGTACACATAACATTAGGAGCGGCAGGAAAATTTGTGCAAGAAAGCCACAACTCCAACAAGCTACAAAATGG
CGCAACCAGAGGGGACAATGCCGACGTGGCAGGCGCAGCAGATCGCCAAGAAGCTCGAGAATGACGTGCGTAATCGGCTGAGTTGATAGCTAGCAGATCG
ATAGATATGTGGCTGTATGTGTGAATATACCATTCGAGCTTGTTTGCGTAGTAGATGGTACCGTCGTCTGCTGAACGAGTGGACCAACAAGAGGTGAAGG
TGGCAAGTGGCTCACTCATTCTCTATCTGATGTGTAGATCCGCCAGTTGAACGTCGCGATGGCAGAGCTGGACGCTGTCAAGCCAAAGAAGGTGCGTGTG
TTGTTTTTGCGCTTGCTTGCTGGAATCTCAATGGCAGCAAATTGATAGCGCATGCTTGTGTTTGTAATACTGTTGCTGCTTTTGGCGATAGGCAACGTAC
GTGAAGCGAGCGAACGTGTTTTTCCTCGACCGGAGAGATATGATTGTCAAGGCCAAGCGAAGTACGTATTCTATACAGACACACCGTAGTTTGCTCGCCG
CAACTCCCATGCCAACTGATTATTCATCCTGTTTTGCTCTCAAATCTGTGGCGTTATGCAGACGAACTCAAGGAGAAAGAGCAGAAGCGTCACAATATTG
GCCTGCAGCTTCGCAGCGCTACCGCATAATGGTGACGAATACACCAGCTTACGCACACATACATAGATACAGCTCTCAAAGTGCATTTCATTCGTTCTGT
AGCCAAGAGGCACAAACTCGGAATAGTCACTATTCCGAGCCAGCTTTGCTTGATTTGTTTGGAAGACCACTTTTGGTCTTCATGAGAGTACTCCCCCGAT
TCTGTGACTGGTATGTTGGTTGCTGCAGGGCAAGTTCAACGCCGCATTTGACAAAGAGAGCCAACACAAACAAGACTCATCAATACTGTACTAATGGCGA
AGAAGCTCGTGGTGATCGGCGGCGCCGGCGCGCTCGGACGAGGCATCAGCGCGCACTTCTCGCGCTCTAAGGCCTGGAAGGCGCTCTCCGTGGACTTCAG
CGCGAACGCGGACGCCGACACGTCCTTCGTGTTTGACAAGACCGATGGCGCGGGCAACACCAGCACCCTCGCTCAGGCGAGCAGCGTGCTCCAGCACATC
AAGAGCACGTGAGTAGCTGTGCATTTGTGTGTGAGAGCCGCTCTGATATGCTATTGTGGTGGGATGCATCGCTGACTCTGATTGTTGATGTGTGTACGGA
GCAGCTTTGGCCGTGTGGACGCGGTGGTGTGCGCTGCTGGGGGCTGGGCTGGCGGCAGCATCAAGGACACAGACACGCTCGCTAACCTCGCGCAGATGCA
CGCGATGAACACCGAGTCTGCGGTTCTGTGTAAGTGACAGTAGTTCCTGCAAGTGGGTATTCCCATTCGACTATGCTATGATGGATCGCTTTTGCTCATT
GCACTTTGTGTTGTTTGTGTAGCTGCTCATCTTGCGAGCAACTTGCTGACCCCTGGTGGGCTCTTGGTGCTCACAGGCGCTGCAGCGGCTATCAAAGCCA
CGCCTGGCATGGTCTCATACGGGATCAGCAAAGCCGGCACGCACCACCTGATCGCCAGCACAGTGTACGTACTCGCGCATTAACGAGCTGAGTTGAAGTT
GTCTTTGTCGAAATGCGCCAGACTCGCGCTAACAAATGGTTCGTTTGCTTCTCTGCCCCTTACGTAGTGACTCTCTTCCGGAAGGCTCGTCTGTTCTTGG
CGTCTTGCCAGCGACGATCGATACGCCGATGAACCGCAAGTACATGGCTGATGCCGATTTTTCCTCATGGACAAAGGTAAGAAATGCAAGATCATGCGTA
TTCATTCACACACACATGCCATGATTCAATCGCGCTCACTTACTTTCTGTGCGGACAATGCACTCACTACAATTCACTCTCAGGTGGAAGACATTGCCGC
GAAAATCTTGGAGTGGTCTGATGCGCCAGCAGCGTCGCGTCCAACCTCCGGCCACCTGATCACTGTGCTCACAGAAAACAACAAGAACGCATGGAAGGAC
ATGGGTAACCCATTCCTTTGAACGTTGCGCTTCCACGAACAAATCTGTTCAGCTAAGAAAGACACACGTGTATGATAGCGGCTATCTCAGGAAGACGCTC
TTTCTTTTGTGATTATGTGAAGCTCTACGTTTGTTTCTTCCATGTTGCTGGTATTTAGTTCTCATTATTGGATTATTGCCGTATTGTCCCTTTTAGATAT
AGGTTCTTGGCACTTTGTGCGTTTGCAAGTATAGGTTGCTTCTAGTTAGTTTACGAGGATACTAGTCCCGTGGACGACGTGGCGCCGTTCCCAGCAACCA
GCGACTTGCGGAAATGGTCGCAGAACGCAGTGAGTACACGTTTGAACTTGCGCGAGTTCTCAATGCACTCCGGCTTGGCGATCGTGCCAGCAAACTCTGT
GCGCGCTCTCACAGCAACGCGCGAGCCCACAAATGCATCGTCAGCGAGCAATCGCTGGATGAGCTCTTCGCTGCGCTGACGTCCAAAGCACGCCCAGCAA
GAGCGTACGACCTCTGCGACTCGCTCGATGAGTGCGGACGGCATCGACCCTCCCGCCGCGTTGAATAGCGCGACTAGCAGGTGGTATTGCACGTCCTTCT
CAAAGAAGAGCGTGCGGATCAGCTGGTGCAGCTGCACCTGGCCTTCGTACTCGCCCGAGCGCAGCAGATCCGCTGGTATCCGCAGCACTTCGCCGTACCA
CGAGCCCACGTCCGAGAGGAAGTCGAGCGTCGCGAGCCCCACTTCCGGGTTCTGCGACTTGAGCGAGTGCAGCACCAGTGCCAGCAGCGACTCCAGCTGG
TTGCAGTGCACGAAGATGAGCGGGCGATGTGAGCCGCAGCTGCGCGCCAGGTCGAGCAGCGACACGATCAGCGACGCACTCTCGTCCACGTTCCCGACTG
CCGCGATGTGCGAAAGCGCGCTCTCAACCACAATCAGCATCACGCGCGTCAAGGACACAACCGACTCGTCGTCGTCACCCGCGCATACGATGATGCTCTT
GATAACTTTCAGGAAATTGCCGTCAGAGCTGCGCGCAAATTGTTCGAGCAAGTGCGGCATGATCGCGGACGCGAGCTCCAGCGCCTGCGTGCGAATCGAG
TCAAAAAGCGCGACCAGCAAGCCACAGAACTTGCCCATGACGTCTTCGTTTGCGCCATACACGCGCAGAATGCCTTCAATCACCTCCCAGTGGCTGCGCA
GCGCGCAGAGAACTGGGTGCGGCACTTCCTGGTTGATCTGCGGCGGGATTTTCATTGCGAGTACGTGCAGATGGGCAAAGAGCTCGCAGAGAAACTCGAC
CGATGCGTCGTCGTCTGATGTGAGCATTGGGAACCGCGTTGCCAGGTCGAGAAACATGATCGCACAGAGCTCATCGACCACAGGCACCGCATCTTTGTAT
GACACCGTCGCGACGACGTACGCGACCGACTCGACGATCATTTGCACGCTGTTGCCCGACAGGTTAGGCTTCTTACCCGCGGGCATAGGCGCGCGGCTCG
TGCGATACAGACTCAGCATCGCGTCGAGCCACGCCTGGTTGAAGAAATGGCTCCCGCAGCGATGAGTGAGCTTCTTCATCGCGACCGTGCCGATGTGGTC
TTCGCCGTTCATGCGCATCCGGAACGGGTAGTTCGGGTGCGCTTCGCTCATCTCGAAGCTCTGGGACATGATCCGGAACGCGTACACGCCCAAGTAGCTT
GGGTTGCGCGCAAACCAGTGGCCCATGACGCCCAGAAAGATCGTGACAGTGCGCGATAACGCCGGGTGGGACGGCTCTTTCCGAGACAAAAACTCAAAAA
GCTGCGGGATCAGTGACGTGTCTTCCTCGCGGATCGACTTGGACAGCGCGCTCAACGCATGCACATATACCTCGGTCTTCTTCCACCACTATTAGGCGTT
ATGGGGGCAAAGTTGTTAGATACAATAATAAAAGGAACACGAAAATGGTTCAGAACCAATATCCATACAAAAACGATAACACAAGATCAGGATCACTCAC
ATTTGGTGGAGCCTGGCCGGCATCGTAGAGCTCGTACTGTCGAAACACGACGTGGATCGCATCGACCACAAATTTGTCCTCGCTCGCCTGTGTGACCGTC
GCGAGTGAGCGGAACACCGCACGCACGTCGTTTCGATAGCTCGTGAACCGGTCGCGCACTGCCATGGGGAAGCTCTCGTAGTCGTCGGGGAACTCCGTTC
GCTCAACCAAGATGCTCAGCAGTCGTGAGATGAACGCTTCAAAGTCCACCATGCGACGCTCGTGCTTGCCCGAGATGTACGCGCGAAAGTCGATCCAAAA
GTCCATGGTCTCGTTCGAGATCTCCAGGTCGTTCATCGCCGTGAAGTACAGGATCGTGTCGAGAAACTCGTACACGAGCGAGCCGGGTTGCAGATCGAGC
GTGTAGTCGACAAAGTACATGATAAACGACTGTCCGCACTCAGCCATCGCAACCGCATAGCCTTTCAAGCAATACCCCATGGCGTCATTCGCGGCGAGGC
GCTCCATAATGTGCTTGCCGAGAATCACAAAGTTCTTCATGACGAGCTCCATCAACGGGATGTACCCGTCGTTGTTGCACGCGCGCACGACTTCCCGGAT
GCACATCAGCGCGTCTTCAGAGAACTGCGGGTTCATGGTTTCTTGGAACGCACGGTCGAGCAGCCCCGAGTCC