Description :
From Genome Similarity Track
Location :
Scaffold_22:16606- 17751
Transcript NameFunction/comments
Phyag_g627hypothetical protein PHYSODRAFT_320485

Sequence
1145 bases(100 bases per row)
TGCTTCCTCCCGCTCAAGCCTCGCTCCACTCCCGTACTCCGCTCGTCCGCAGCGTCTTCACCCTGGCCCAAGCCTCGATGCGTCTTCTCACCACTCTggt
tctcctgctgctctcggcCAGCCACGTCGCGGCCCGTGTCGTCCGCTACGACTGGAACATCACGACGCTCAATACGACCATCTTCGACGGCGTCCGCGGC
AAATTGGGCTACGGCATCAACAACGAGCCGTGCGACCAGCACCCGATCGACGTGACCTTCGGCGACGAGGTCGAGGTGCACGTGACCAACCAACTCACGG
AGCAGACGTGCATCCACTGGCACGGACTGCGGCAGTTCGGTACCCAAGAGATGGACGGCGTCTCGGGCATCACGCAGTGCCAGATCCAACCGGGCGTGAC
GGCCATCTACCGGTTCAAGCCTGACAAGTGCGGCACCTTCTGGTTCCACGGCCACGAGGAGGTGCAGTACGCCTTCGGTCTCCGCGGCCCGCTCATCGTC
CGCTGCCcggccaagctgcagcagagctgggAGAAGGACGTCTACAAAGAGTACACGATCCTGCTGGCCGATTGGTACCATGATCTACCGGTGGGGGCTC
CGATCTGGGACACCGTGCTGATCAACAACATCGGCCGGTACAACTGCACagtggctgaagctgctggcttggAGTGCGGCCCTGACCGCCCCTTGCCTCG
GTTCCAGTTCGTTCCTGGTAAGAAGTATCTGCTCCGACTCATCAACAcgtcggccatggcggcGTTCAAGGTGAGCATCGACGGACACACGTTCCAAGTG
GTGGCGAGTGACGCCGACTACCTCAAGCCCTCGACGCTGGTGAACGCGGTGACGATCAACGTGGCTCAGCGCTACGACATTCTCGTGCAGGCCAAGTCTT
CCGCATCGCAGAGCCAAGCCCAAGTCGGCcagaaggcggtggcggAGCTTGGCTCCTTCTGGCTGCGGGTCAACTCGCACTACGGCCTTCCGTGGACGGC
ACGTACCGTCGACGATCTCCCGGACGGCTTCAATCCGGACGCCCTCGCCATCATTGACTACCAGAGTAAAGCGACTGCGGACCCAACCACGTCGGCCTGG
GCGACGGACGTGACCATCGGTGAGTTCGACTACAACCCCGTGAGC