Description :
From Genome Similarity Track
Location :
contig_113:16605- 19323
Transcript NameFunction/comments
g13786.t1hypothetical protein

Sequence
2718 bases(100 bases per row)
GTGGTATTTCTTGAGTCGCCCGACGTAGAACGTCGGGTGTAGTCGTAGGGAAAATGGTATGCCCAGTGTGTAGGCATCACCGATTACCTTCGTAACCCTG
AAGGGACCAATAAAGCGCGGCGCGAGTTTGCTCGTGCCAAGATTCGTTACGGCCGAAGAGCGTATGCCGTCTGTCGACAGGAGCACGCGATCTCCTGTCG
TAAATGTAGCCACGTTCTTGCGCCCACGCTTGTCGGCGTTCTCCTTCTGCTTATCCACTGCTTCTTGCAGTGCATCTCGTACAAATCGGGTGACCGATTG
TCGCTGCAGCACGAACTCAGAGACGGCCGCATCATCGACTGGACGCGCCGGAGGCTTCGGCGCGTAGTTAGCTGCGACGGGATCGGTAGCCGGGCCAGGG
TTGATTAACGTGCGCGCAGTCCAATCTGTCAGTGAAGACACCGCGTTGTTCGGCGTCGCAAGGGTCCGTCTCGACTTCGCGCGGGTGACTGCATTCAGCG
TCACGGACTGGTGGGCTGCACTCGACAAGGGAGCTGGTGGTGGTGGTGTGCCATCCGTGCTCACCACTGGTAATACCGGTATCGGTATCGGTGTGTCTGT
GTTCGTACTACCAGCACCATCATTTCCTTCCCCACCCAGAGTGGAGCCACGAGGCATCGTGGGGTGGCCCACGGCGAGCAGAGCGGGAACGCGCGGGTGC
CGCGCGTTATTTACAAAAAAAGGGGTCAGACCCGTCGATGCGTGTTCCGCGTTGTTTAGCGCAAACTCGGCAAGCGGCAAAAAGGAGCTCCAACTAGTGA
ACGAAGTCGCGTAACTTCGAAGGACATCTTCGAGGACTCGGTTGACCCGCTCCGTTTGACCATCCGTCTCCGGATGCGCCGCCGTTGACATGAGCAGCTT
CGTTCCCAGAAGTTGGAAGAGACTCGACCAGAATGCCGACGTGAACCGCGGATCGCGGTCAGAGACGATCGATTCAGGTAAGCCGTGGTGTCGAAAGACC
GCGTCAACGAAATGCACCGCGGACTCAGCCGCGGTGATCGTGTCGGACACCGGAATGAGATGCACCATCTTGCTGAACCTATCCACAAACACCAAGACGC
CAGTCCGACCGTCGGCATCGGGTGGAAGCCCGAAGATGAAGTCCATCGACACTGAGCGCCACGCCTCAGTTGCAATCGGCAGGGGTCGCAGGGGAGCCTG
CGACGACTTTGACGGCTTCACGCGCTGGCAAATCTCACAAGTACGGACCCACTTGCGCACCCATTTGTACATGTGGGGCCAGTAGAAGTCGCGGGATACT
GCCGCGAACGTCTTTTCGCGGCCCAAGTGACCACCGACAGGGCTGTCGTGGAACTCGTGGATGATCCGAGCGCGCAGATCATCGTCGTTCGGGATGGCGA
TGCGGGGAGCATCGAATCGATCGATGCTGTACGTCAGCAGATCGCCGTCGAGTTGATATCGGTTAATCTGATTGCGCGTGTTGTTCGGCAGCGCGTGGAG
TGTTTTATCACTGGGGGAAAGAAGATGTGCGAGGATGGCGGCATATACCGCGTCGTCGTTGTACGCAACGGCAATTTCTTCGCGTAGCGGCATTTCTGGA
GTCACGTTCATCAGGTTGACACCTGATGTCAAGCACATCGCACAGTGATCTTCGTCATCCTCGTCTTCGTCAATCACTTGACGACCCCGCGTCGCTCGTG
GATCATAGTCTGGACGCCGAGACAGAGCATCGGCGAGGATATTGTTCTTGCCGGGCTTGTAGTGCACGACGAAGTTGTACTCAGCGAAGAACGACAGCCA
TCGTGCCATGCGTTGAGACAGATGTGGAGACTTCATCGCTGTGCGCAGCGATGCGTGATCCGTGTACACCGCGAACGTCTGTTCTCCGAGCAGGTACACT
CTGAATTTGATCAGAGCGTATCGCATCGCAAGAAGTTCCTTGTCGTGGACGGGATAGTTGCGTTCGGCCGGCTTCATCTGTCGTGATTGATAGCTCACGA
CTAGTTCGCGGCCTTCGTTGTCAAACTGCGTGAGCGCGCACCCGATAGCAAAGTCGCTAGCGTCGCAGACGACGTGAAACGGTTTCGCGTCATCTGGGAG
CATCAGTATTGGCGCCGAGGCCAAGCTCTTCTTCACCGAGTCGAAGGCTACTTGATGCTCGGGGCGCCACGACCACGTGGCGTCTTTCTTCAACAGCGAC
GACAGTGGCTGTATCAAGCCGGCATATCCCTTCGTATACTTGTGCAAGTAGTTAGCGAGGCCCAACCACTGACGCAGCTCAGTGGGGTTTGATGGTGGTG
GCCACGAGCAAATAGACGACACTTTTTCCGGGTCAGCACGGACTCCGTTTTTGCTTACGTAGCACCCAAGCACCGGAATTTCCGGCGCGCAGAAGACACA
CTTCTTGAGATTCGCGTAGAGCTTGTTCTCTCTCATCACTTGAAAGACCTGCCTCAAGTGCCGCAGATGCACGTCGATCGCGCTGAGACCCTCTTCAGCG
TGACTGTGCACAAAAATGTCATCGAAGTAACTCGGAGCGAAGTCACGAAGCGGGCGTAGCACATGGGACACCATGCGATTAAATGTGGCTGGTGCGTTCT
TCAGACCTTGGGGCATCACGAGCCACTCCCAGAGCATACCGCTGGGCGTACTGACTGCCGTGAGAGGTACATCGCTCTCTCTCATGAGGATCTGATAGAA
GCCATCGGTCAAGTCGAT