Description :
From Genome Similarity Track
Location :
Scaffold_22:166011- 167572
Sequence
1561 bases(100 bases per row)
ACTTGTACGCTTCCTCATCACTACGTGTAAGCAAGTAACGGACACCCCAGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCCATGACCAAGTTCAC
GATGAGCCAAGGTATGACGTCTGAAACTCCAGGGCCGACCCTGGAACATGCTGCTTTCCCTCATCTCACTCGTGTCGAGTGGGAAGCCCTTCACCGCCTC
GCGGCGGTGTCTGGTGAGGCTGTAATCGCGTCGCTGCTGAGCTCAGCGACGTCCGACCAACAACGCCAAGCAGCCCAAGAGTTCATGGAACGCGAGCTAG
CCGATGCGAATCGGCGAGCAACAACTCCCGCGCGTTCCTCGAAAAATGATGTCGTGAAGCTAGAGACGTCTACCTACTCCGGTGAAGGAGCGAATCGCCT
CCCGCTGAACCGGTGGTTTCGCGAGGTCGACATCGCGATTGCTTCGAGAATGATCGAAGCGCAAGGGATAAAGGTCAACTTCTTATTGTCCCGGCTGTCC
GGGAAGGCCAAGGAATGGGCCCTCGGTAAACTTGTCGTTGATCACGACGCATTCCCCACTCTGGAGTCTCTCCAGAAAGATCTCAGGCTCGCGTTCGAGC
CACCTCAAGACGAATCCCGCGTGCGTGCCGAGTTCTTCGCCCTTCGTCAAGGCAAAATGACAATGCGCGACTACGTTCAAAAGACTCGCCACCTCGCGTC
ATGCATCGTGACAAATCCGATTGACGCAGCATCGCAGGTCCATGTATTCGTATTCGGCATGCGTGAAGGCATGACACGGTACTGCCTGACCCGAGCGGAA
CCTTCCTCTCTCGAGGAAGCATTCGCCCTCGCGTTACGCGAAGACTACGTTGTGGCGGCGTCTTACGCGCGCGCGATGTCAACGGCAGCTCGTGAGTCAG
CTCCCGAGCCCATGGAGATCAACGCGATTGACGCATCGAATAATCATCGTCAGCCGACTCCTCGTGGACCCAACGGCCGTCCTAATCGCCCGCTCACTTG
CTTCCGCTGCCGGAAGATCGGTCATCGCGCGGCGGAATGCCGCGCGCCAGCGCCGGTACTCGCGCACACCGCTGAAGTCTCACCTGCCGTTCAGTCAAAA
AACGGTCAGGGCCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGCCCCCCGGTGGCTACCCAACCTTCTAGCCCTCCTGTGCTCCACGC
ACACTTTAATGCCACCACCACGTCGGGCGACTTGAGGCTAATCATCGTCAGTCTTCATGTCGCCGGCGCCCGGCGACCACTTCGCGCGCTCCTGGACTCA
GGAGCGTCGAATAACTTCTTTCGCGAATCGTGCTTATCGATGCTTCCAAGAGAGATCGCAGTCCGTAATGGTCGAGGTCAGGTCGTCGTCAAACTTGCTG
ACGGAAAGCCACGCCGCGCTGCGCGGCGCGAAATCACGTTGCCATACACATTCGACGGCTTCCGCAGCAGCGACGACTTCCTCGTGATTGAGATGAACTA
CGCGTTCGACTGCATCTTGGGTATCCCGTGGCTGTCACGATATCAACCAGAGATTGACTGG