Description :
From Genome Similarity Track
Location :
Scaffold_637:1660- 3487
Transcript NameFunction/comments
Phyin_T30-4PITG_21900Putative uncharacterized protein
Phyin_T30-4PITG_21901Putative uncharacterized protein

Sequence
1827 bases(100 bases per row)
ATTTTCCCAGACAACTACAACCACTGCAGGTTATGGTGCTCTTTGTTTTTCTTCTTGTCCAGCTTTCTGCTCAGTCTGGAATCCAAAGTAACTGTTTAAA
ACAGGGTCGATCAGCCTTCGTCAAATTGAACAGCTTGAGTTTACTAGGTGTCACGGAACTAAACCGTTCCGTGAAAGCTTAAGCAGTTGCGAAACTACCC
GGTAAGAGATATAGAAACGACTTCACAAAAAGACAGAAACCACTACAGCGACTCTTGGTAGCACGCGACCCTCGAGAGTCGACGGAAGACAAACTAAAAC
AAAATACACTTTGAGTTATTCCATCTACTACGCAAGTCCTCGCCAACAACGTCTACAATCTTATTCTGGCCAGGTCGGAGTCCCCTCAAAGTCCCCCGCT
CGATTTCAACTCTACGCTTCCACCTACCTCTTTGTGGTGTCCCGAGACGTAGGTCTCATTCGGACGGGAATCCACCATATGTGCAACATAGTAGACCTTG
AAGTAGGAGTCAACAAAATGAGCGACGTCGGCAGTGAACTCGACGTAGCGGGAGACACTCGCTCACTTGACGCCGAAGAGATAGATCGACTTCGGCTGGT
CTTGTCAAATCTAGAAGCGCTGTAGTGTTTGTGAACAAACACTACACACGCTGACACGAGACCAAACAAGTCTGACCGAAGCTGTTGCGGTATTCGCTAC
GCGAACCGATCGGCGACAGAGCCAGAACATGGAACAGATTAAGGCAAAGCAGGCCTTGCTTCATGAGGTGATTAACCAGATCCAGAGTTTTGCTGATGAA
GAAATGGCCAAGCAAAAAACCGACTTGGCCTCGCTAGGAAGAGAAATGGATGCACTACGACAAGGCATTCAAATGCAAAAACCCACCTCGCAGAACGTCG
ACCAATCAGTTAGCAGCCACGGGTACAGGAACGAAGAAGAACTATATGTAGAGTGGGATGTTGTGGGATCAAGTCCGCCCAACGCACCCAGTTTCACCAA
TCTGGAGCTAAAAAGTCGAGTATCAATGTACTTGAAGCAAAAGGAAACACCGGTGTATGGTGGTACTGAAGACGACGACATCGACGTGTACGTGCTCAAC
ATGATATCGTGGTACGCAGCATACGGTCTTTACTTGAGTCAAGATCAAGTCGATTGGCGTGTTGGTGAGCTCACGTAAAACCATACAAAAGGAACCGCAA
CGAAGTGGCTCTGCAAGACTATAAGGGCGAACGACGCTGGAATCATATTGTGAAAAAAATGAAGCAGCGATTTGTGACCCGATCCCGAGAAGAAGACCTT
GTTGTGAGCTTCTTCGATTGCAACCAAGGAAGTATTTTTTTGGATACATATATCGACAAATTTCAGCGTCTGAGTCGCAGCAATGATGTATCCGAAAAGT
ACAAGATGATTAAATTCAAGAAGGGCCTGCGCTCGAACCAGTTAAGGGAACTATTTAAGACCCAGATACACGAGTCATTGGACGAACTGTTCGATGTGGC
CCGATAATTAACCCTCGCGATGTACCAGCTGAAAAACCGACTGGAAGCCAGAACCTTTATCCGGGTTCAAACAAAAAAGCTGGTGCTTTCAAAAACAAGA
GCAATGAGCTCGGTAAATGTAGCTCGTATCGGTGTCTCGAGAAGGGACATACAGAAGACAAGTGTTGGATGCTGCATCCGGAGCTGCGTCCGGCATGGTT
TAAAGATAGAGGAGGAAAGCGACTCGGAGCTGCATCAGCAGTGGTCGCACATTGTATCTCGGCTACGACAAGCGACAACGACAAAATGTGGGAAGTGTTA
AGTGCTATTCAGATAGACCTTGCCAAG