Description :
From Genome Similarity Track
Location :
Scaffold_2397:1660- 3009
Sequence
1349 bases(100 bases per row)
TTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGACGACCGTTGTATGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACAACCTGGATCGAGTCC
GGGGAAACCTGGGAACGGCCAGACCAGTTAAGGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCGACCGTAATCCAGGGAC
CAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGAACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTAT
CCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGCAGAG
GTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAG
CAATGGAAGTTGGATTCAGGACGGGGGACGATCCTCAGAGTCGGCTCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCA
GCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGG
GTTTAAACTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTTCCCGGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGG
GTCGCGGTGTTTGGATCCAATGGTGGATCCTACGAGGACGGAAGATGAGCAAGTCTGCTACCGTGAAGGCGTGGATCTACACGCCGAGGATCTGGGAGAA
GGCATGGCGGTAATCCCGGAGGTGCCACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATCCAGGGGCGAACGAACCCACTGAAGTGGATC
GTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATTTGACATCGATGTCGG
CGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGGAAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATC
AGTTTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGTATTGATTACCGGCTGGATAACGGTC
TGACTCGATTGATGGTGTACCCGATGCCTCTAATCAATGAGCTGTTGGA