Description :
From Genome Similarity Track
Location :
Scaffold_2934:166- 2718
Sequence
2552 bases(100 bases per row)
GAGGAAATGACGGTCGAGTCTTTCCTGGCCAACCTCAAGGCTGAAGAGATTGCTGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACG
CTTCCTCTGTCTTGGACGAGAACGCCCTGGAAGACCTCAACAAGCAGCGTCAGACGAGCTTTGGTTCTGAGATTCTTAAGAACCCCAAGGATCCGGTGTA
TCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGC
ACAAAGTATTGTGTCACGAGGCAATGGCTTCTCGTGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGG
AGTCGAAACCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGT
GCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGAATTTGGTAGACGGATACTACCAA
ATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGCAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAGCGCCC
CGGCGACGTTTAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAAGG
AGGCAAGACGGCCATGGAGGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGCCAAGTGTGTTTTC
GCGTCACCAGAGATTAAAGTTCTCGGTTGATTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCC
GATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCC
TTCAGAAGAACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGA
CGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACAGGAACGAGTCATCTCG
TTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGAAATGAAATATGCCCTTGTGAAGTTCAGTGCTCACC
TTCTGGGCTCTAGACCCTTTGTGATCTACACAGACCACGCGTCTTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGCCGAGGTGGCTGTC
CTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGCTGGCCCAC
ATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGATGATGAGGCTGTCACGCCTATCGTCAAGTTCCTTAAGGCCGGAACGA
GCGCGAAACCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTAAAGGAGGGCCTCCTCTATTATCGGGCGAAGCCCACTGATCCT
CCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCT
TTCTGTCGGTCTCTCAACCCCTTCAGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGCTCAAACCCGCAG
GGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGGTTGTTGGAAGTCGATGAGTCTTGACTTCATCTGTGGGCTTCCCGCCGACGGACACGG
CAACACCGGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGACACAATCCGCAGGGTTGTT
CGTCGATGGCGTGTTCCGCTACCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCCCCGGTTCACTGCCGCGTTTTTAGAAAACGCTGTTCCCTT
TACTAAGAACTCGTCTGCAGATTTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGATCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAATGT
GTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTACGCTCAACACCCCGATGCACGCGTCCACGGGGTTCACGCCGTTCTAC
TTGAACGGCTTTCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTG