Description :
From Genome Similarity Track
Location :
Scaffold_2868:166- 2470
Transcript NameFunction/comments
Phypl_g15448hypothetical protein PHYSODRAFT_325775

Sequence
2304 bases(100 bases per row)
tccagcagttcaAGTCGTCATGCTTGCTGGATCCGCAGTGGGAACATGGCTTCGACGGGAAGTCCGGGTCCGATCGATCCTGCGGTCCCGCCGCGCCTGG
GCGTGGTGGCTGCCAGTTGCCTTGATCCTGACGATCGGCCTTCGCGGCGAGGTAGATCGGGCGCAGATCGCCTTCTGGTTCCGATCCGCTGGCttccgac
tcggactcgtTGAGGCCTTCCTTCGATCGTATCGCTCGAGCCGCGCGGGCAGGTTTCGAGGGAGCCGGATGCGTTGGAGGTGCAGCCTTCTGGCGGAACT
TGCTCAATCCGATCGCTGCCTTTCCTTGGTGGGTCTTGGCGCGCTGGCGTGAATGCAGCGTATTTTCGAGATGGCCCGCTTCGGCGATCATCAGTAGCGC
CAGCTGATCCGCCAGATCACGATCGTCCAATGTTTCAATGAAGTGTTCGACGTGTTCCCGGCGAGCGTCCGGCGATCCATCCTTGATCGGGAGTTTCGCT
CGCATTCCAGCAACGTTCAGTCGGTGGAGATACTCGAGCGGTGATTCCTCGGATCGCTTCCTCGCGTGATAGTACTGTCTCGCAACAGACACTCCACGTC
CGCAATACTGGATCAGGAAATCCTCCAGCAgactcttccagctgcttcgCGTCGTCCGACTCAGCTGACGGTACCAGTTGCGGGCTGGTCCCGTGAGCAG
ATCGCCGAAGACCAAGCACTTCTCGCTGTCTGGAGCCTGACCACGGATTAACGCCGACTTGACTTTGCCGAGCCAACTCCTGGTGCGatcttcgtcgttg
tcctTCCCCGAGAACTCATTAAGTTCCGAGATCGCGGACACTCGGATTCGTgcggccgacgtggcgccCCCAATCGTTGCTTCTGTGGTCGCCACCACAG
CACGTCGAGGCCTGCCGATACTCAAGTCATCCGGATCGTATTCGTCCGCCGGAGATGGATCATGATCCAATCCGACCGACATCATCTCAACGTCTGGCGC
ATCGCTCGGTCTTGGCTTCTCGGGCGACTTTGGCGTCTCACGGGGCGGTGGCATCcgctcctgcagctcacgtggtggtggcatcTCGGCCCCTTGCTGT
TCCTTCAAGAATCGAGACTTCGCAGCGTTGAGGAACGTCTGCATGCGATCTGGCGAGTTCTGGCCCGAGGCAGGcttcgcctccttcttccgAGCTTCCA
GCATGGCGGTGCCAGCCAGTCCCAGCGCCATCCGCTTCACCTCAATCGAACTGTTTGATCCAGCATCCGACGTGGTCGACGCGTACTGCGAGGATCCGCT
GCGCTGTGCCACCATCGTTGCAGCCGGTGTGGCTTCTCCGACTAGAGCAGCCAGCTTCTTAAAGAGAgcgagcgtcgtcttcgtggtcGCGGCCAGTTCC
AGATCGAACAACTCGTTCGCGTCGAACGCTCCTGGCACGATCCCAGCTTCCTTCAGCATGCGCATCAGGAGCttcaccgcgtccagcttATTGAGCACTT
CCCTGGGTGCGGTTACAGGTCCTCGAAGATCCCCGATCAGCTTCAGACGCATGATCTTCAGAACCGGATCCTCGACCAGCAACGCGTACAGTCCTTTTCG
GTAGAAGACTGCTTCCTGCTGATCGTCGGTCCAGTCCTCAAGCCCAGTGCGATCTTCAGAGTCGGACTCCGGGGCCAATCCCTGGCTCAGCCTTGATCTT
GACATCTTCTTCGGTGGACTCACGGTGAAATCCAGAGTCACCAGAAgatccgggcacgcgcaccattgtggcggagcaggaatCGCGAATTTGCTAACAC
GATCCAAGCTAGCCAACGGTTGCCCAGACTACCAACTTACAgagggggtactccgttCGTCCGTGGGGGCTGAAGtcttctcaccttgtgtacccgttgg
ttgggcgggttacgctcttccggtgacggcgaagacgtctGTGCGATCTTGAGTTGAGTTTGTGTGGACGGTACTTGGGGGATTGTTGGTGACAGCTgcg
tggaaatcttcactTGGCTGTCGAGTGTAACCGACCAGGGTCTTGGATGTGCCTTGGTCCACTCGTGGGGGTGTCCTTGGGGGTTCCTTTCCGTGCGTGC
CGCTTCCTGTTGGCGGGATCTTTGAGTGgagagaaggtggaggcCTGGCCAAGCAATCCAGGtgtcttcggcgtcttctccgtgagGGACTTGGtgccgt
cttggtcgtcgggaGGGCTAATATACTTCCCAGCCCGGAATCCAAAGGCACTTGTGTCTTACAAGGAAAATCTTTCACTGTTATGTACCTTACCTCCTTC
CTAT